Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig82
Contig Information
Length 843 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2i03    rwhv16n2i03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0392700 [Oryza sativa (japonica cultivar-group)] >gi|54287522|gb|AAV31266.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579003|dbj|BAF17366.1| Os05g0392700 [Oryza sativa (japonica cultivar-group)] >gi|125594137|gb|EAZ34196.1| hypothetical protein OsJ_017679 [Oryza sativa (japonica cultivar-group)] >gi|215706991|dbj|BAG93451.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737524|dbj|BAG96654.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765088|dbj|BAG86785.1| unnamed protein product [Oryza sativa Japonica Group]
Score 637
Evalue 2.47632e-65
Total Hit Count 418
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig82
CTTGGCTTGAGGCATTCGATGGCTTGGGGCATTTCCCTCTTGTTGACATGCAATCCTTCTATTCAGTACACCGTGTTTGACCAGCTTAAGCAGAAGCTAA
TTCTGAGGCAGACGCGTAAAAACGCAGAATCAGCGGGTGATTCTTCCCCGGTTGCTCTTTCTGCTTTCTCGGCATTTCTCCTTGGTGCCATCTCAAAAAG
TGTTGCAACAATCTTGACTTACCCATTAATCAGGTGCAAGGTCATGATTCAGGCTGCAGACCCCGATGAGGACGACGAGGACGAATCTGAAAAGCCAGGC
AATTCAAGGCCTCCCAAAACAATGTTGGGCGCCATGCATGCAATGTGGAACAAGGAAGGCATCCCAGGGTTCTTCAAAGGGTTACATGCTCAGATACTAA
AGACAGTTCTGAGCTCCGCATTACTGCTGATGATAAAAGAGAAGATTTCAAAGTTCACTTGGATCTCGCTGCTTGCCCTGCGGCGATATCTCTTTGTTTC
TCGGAAGAGAATCAAGAGTGCATAGTTGTATCATGCATATGTCAGACCTGAGAAAACCAGTCTAATCGTCCACTGGTATTTCAAGATCGTATTATACCAA
ATAACAGAAGTACAGAAGCAGAACAGCACGATCATCTTGAGAGCGCCATGGAATGTTCTGAATAAATTTGTTTGTTTTTCCATGTAGTAGCTCTGAGCAT
CTGATTCGTACTTGGAATGTAATGGAATGAAGTGGAATAGGTGTTGTCCAGAAGTAGTTCTGGTGATGTGATTGTGGTCTGGTAGACTGGTACCATACGT
GTAAAATATCACTTTTGTTCTATTCTTTCTTTCTTTGCTGGAA
page-top