Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig73
Contig Information
Length 579 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2k09    rwhv16n2k09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_016000 [Oryza sativa (japonica cultivar-group)]
Score 460
Evalue 2.25301e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig73
CTTATCCCCATTCCCCAATCCGACCTCCTAATCCCCCGAGCGAGAGCAAGAGAAGGAAGGCGAACGAAGATGCTGCTGGGCTCCTCCTTCGCGTCGCCGT
TCACCCAGCTGCACCTCTCGCCGAGCCCCAATGCGGGGGCGCGGCCGGCGGGGATGGTGCTGCGGATCGAGGCGGCGAAGCAGCTGACGGGGCGGGTGGT
GACGACCAAGGCGAACAAGACGGTGGGGGTGGAGGTGGCGCGGCTGAGGCAGCACCCAAAGTACCACCGCCGGGAGAAGATCAAGAAGAAGTACCAGGCG
CACGACCCCGACAACCAGTTCAAGGTCGGCGACGTCGTCGAGCTCGTCCGCTCCCGCCCCATCTCCAAGACCAAGCACTTCCTCGCCGTCCCCGTCCCGC
CCCGCGACACCCGCCGCAAGGCCCAGCTCCTGCCCCCGCTCGAGTCCCAGTCCCAGGCCGGCGATGACTCCGCCGCCGCCGAAGAGACCGCTGCCTAGTG
ATGCTTTCCCCCATTCTCTTCTCCGTTAATTAATCGTTGTTCCCTTTGCTATTTCTGTTGTTCTTGCTCCCCTGTATCG
page-top