Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig70
Contig Information
Length 555 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2l13    rwhv16n2l13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chlorophyll A-B-binding protein 2 precursor, 5' partial; 1-750 [Arabidopsis thaliana]
Score 406
Evalue 3.62565e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig70
GCGCCTCCCACTGCCAGCCTCAGCTCACCCGAAGCAAAGCTAGCGAGTAGCACGCAATGGCGGGCGCGACCATGGCGCTCTCCTCCCCGGCGGCAGCTTC
GACCCCCTGGGCCTCGCCGAGGACCCCGAGGCGTTCGCGGAGCTCAAGGTGAAGGAGATCAAGAACGGCCGCCTCGCCATGTTCTCCATGTTCGGCTTCT
TCGTGCAGGCCATCGTCACCGGCAAGGGGCCCCTGGAGAACCTCGCCGACCACCTCGCCGACCCCGTCAACAACAACGCCTGGGCCTTCGCCACCAACTT
CGTCCCCGGCAAGTGAGCGCGGTCAGCTCAACCTCTAGGCCGACAACTTCATGGCTGATGGATGCTGCTGCATGTGTGTCGTCGTCGATCTCTGCTTCTT
CCCGTTGTGAGATTGAGTAGTCCGGACTGATAGATGTTGCATGTGAGGGCGAGTCGAGATGAGGAGTTGGTGTGTGTACACTAAGATGGTGTTTGTGTAA
TATCTGGCTATTTTCTCAGATTAATCAAGGCATCTCTGTTCTTCTAAAAAAAAAA
page-top