Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig68
Contig Information
Length 1072 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12k24    rwhv16n12k24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216858 [Zea mays] >gi|194696758|gb|ACF82463.1| unknown [Zea mays] >gi|194705662|gb|ACF86915.1| unknown [Zea mays] >gi|195623184|gb|ACG33422.1| vesicle-associated membrane protein 727 [Zea mays]
Score 548
Evalue 8.22807e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig68
GAGGAGGACGGCCAACCCCTGCGCTAGACGAGCCTCTACAAGTATTCCCCATCAATCTGGGTCAATCGAGGGCTTCTGCGGTGGCTAATTTCGGGAGGTA
GAAGAGGGAGGAGGAGCCATGAACGGTGGTAGCAAGCAAACGCTGATATACAGCTTCGTGGCCAAGGGCTCCGTGGTGCTGGCCGAGCACACGGCCTTCT
CCGGCAACTTCAGCACCATCGCCGTGCAGTGCCTCCAGAAGCTGCCCTCCAACAGCACCAGGTCCACCTACTCCTGCGATGGCCACACCTTCAACTTCCT
CGTTGACCCGTGGTTTTGTGTTTCTTGTGGTGGCCGAAGAGGCGTTGGGAAGGAGCGTGCCGTTTGTGTTCCTAGAGAGGGTTAGGGAAGACTTCATGCA
GAGGTATGGGTCCAGTATCGATGAGGAGGGACAACACCCGCTTGCTGATGATGCGGATGAGGACGATTTCCTGTTTGAGGACCGGTTTAGCATCGCCTAC
AATCTTGACCGGGAATTCGGGCCAAGGTTGAAGGATCACATGCAGTATTGTATTAATCATCCAGAGGAAATTAGCAAGCTCTCTAAGGTGAAATCACATC
TTTCAGAGGTTAAAGGGATCATGATGGACAACATCGAGAAGATATTAGATCGTGGCGAGAAGATTGAACTTTTGGTGGGCAAGACCCGAAACCTTACAGT
CGCAGGCCGACAGCTTCCATAGGCATGGCAGAGAGCTCAGGCGCAAGATGTGGCTTCAGAACCTGAGGTTTAAGCTGATGGTCTGTGGTGGCATCGCATT
TTTGATCCTCATCCTCTGGCTAATGGTTTGCAGGGGCTTCAAGTGCTAGAGAGTTCAGAGTCTTCATTTGCCCTTTTTTCCTTGTCATTTGATGTTCTGT
TTACCGTGTCATGTGCATATAATGACCACCAAATTATGCTTTCGCTATGTTCCGAACACAGTTATGTGGTGTGAGACCCTTAATTCCTCATAGACCATCC
TTATGTTCCATAAGACCATAGGGATCTGGAGTACTTGTGTAAGCTTTATGAGAGAGGGGGACGTCACTCGAT
page-top