Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig67
Contig Information
Length 312 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n2l14    rwhv16n2l14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit oxygen evolving enhancer protein 3 [Zea mays]
Score 168
Evalue 9.74905e-11
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig67
CCTCGTGCCGTGACCGAGTTCGACCGGTTTGTGCGGACTCCCAAGGTGTACGAGTCGTACCTCTACTATGAGAAGACCCTGAAGTCCCTGGATGACGTGG
CAGAGTTCCTTGGATGATCGTATATACTGTGTTCGTAGGTCTAGGAATGTATTCCCGTCGATTCCTTCCGTGAAGTGTTAATATTTACTGATATACCATA
AACATGATTATGTAAATTGTCATGTTGCTTCAGCAAATATGCATGTACTAGATGCAAAAAGTCATTTTGGTTGACGAGCACCTGTGCGCTCGTTATTTGG
TTAAAAAAAAAA
page-top