Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig66
Contig Information
Length 1257 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12k22    rwhv16n12k22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1208
Evalue 1.70172e-130
Total Hit Count 437
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig66
GCTCTCCATCTCTCTGTCCCCATACGCCTCGCCTCTTGAGCGCGCTCTTGAAGGAAGGCTCGACACCTCTGCCTTCTGCTCTCCTCGGCTCTGCATCCGT
GAGAGCTGTTGCATTGCTGCAGCTCGCGAGCGCCCGGGTCGTTAGTAGTTCTTTCACCACAGCCCGGATCATGGAGTTCGACGAGCGCTGCCTCAAGGTC
CAGGACCCCAAATTTGATTGCCTCCTCTTTGACCTGGACGACACTCTGTACCCGCTGAGCTCGGGGATCTCATCACACGTCAAGACTAACATTGAAGCTT
ACATGGTTGAGAAGCTGGGTATTGAGGAGAGCAAGATCGAAAACCTTGGCAACCTGCTGTACAAGAACTATGGCACCACGATGGCGGGCCTCAGGGCAAT
TGGCTACAACTTCGACTACGATGAGTACCACAGCTTTGTCCATGGAAGACTGCCCTACGACAACATCAAGCCCGACCCCGTTCTCAAGCAGATTCTCAAG
AACATGCGCATGCGCAAGCTCATTTTCACCAACGGTGACATGATCCATGCCGTGAGAGCCCTCAAGAGGCTGGGCCTGGAGGACTGCTTCGAGGGGATCA
TCTGCTTCGAGACCCTGAACCCGCCGTGCCTGCTGACGCCGTGCGACCAGGCGCCGGAGATCTTCGACATCGCCGGCCACTTCGCCGGGTTAGGCAGCGC
CGACGACCTGCCCAGGACCCCCGTCCTATGCAAGCCCAACGTCGGCGCCATGGAGGCGGCCCTCAGGATCGCCAACGTCAACCCTTACAAGGCGATTTTC
TTCGACGACAGCGTGCGCAACATTCAGGCTGGCAAGCGAATCGGCCTCCACACAGTGCTGGTTGGCACGTCACAGCGGGTGAAGGGCGCGGATCACGCGC
TGGAGAGCATCCACAACATCCGGGAGGCGCTGCCGGAGCTGTGGGAGGAGGCCGAGAAGACGGAGGACGTGCTCTACTCGGACCGCGTGGCGATCGAGAC
CTCGGTGACCGCGTAGACGCCGCTGGCTCTCGGTGCACCTTCAGTCTGATACCCCAAGCGCAACCCGATTCGACCCCAGCCTGCCGGACAGATGATCTTC
ACGTGGAATGCTCTTCAGCATTGGCCGGGAAACCAGTACAGTATCCATCACGAGGAGAGGAGGGGGAGTTCAGAAAGTCAGGAATTAATGCAGCATGCGC
ACCATGCCGGGCCGGTCCTAATATATGTATATGTATGTGTCGATCAGATCTTTGCTT
page-top