Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig65
Contig Information
Length 883 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n1o08    rwhv16n1o08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative aldehyde decarbonylase enzyme CER1;1 [Hordeum vulgare]
Score 1074
Evalue 3.42279e-115
Total Hit Count 96
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig65
CCTTGGACTTCTGAATCAGGCGCATAGCCTCAATGGAAGTGGAGAACTTTATCTGCAGAAATACCCAAAGATGGGGGTAAGACTTGTGGATGGCACTAGC
CTAGCTGCTGCAGTGGTCATCGACACTATTCCCCGAGGCACAAATCAAGTTATCCTAGCGGGAAAGATTTCGAAGGTGGCTCGTAGTGTTGCTGCGGCAC
TCTGCAAGAAAAACGTCAAAGTCATAATGACAAACAAGCAGGAGTACCATCTCCTGAAGCCTTGTATACCAGAAAATGAAGCCGGGAATCTTTTATTATC
AACAACTAGCACTACAGAGGTGTGGCTCATTGGAGAAGGTCTGGATGCTGCTGAGCAGTTCAGGGCACCGCAAGGAACAAAGTTCATCCCATTCTCACAG
TTCCCGCCAAAGATGGCGCGCAAGGACTGCTGCACCTATGCTATGACTCCTGCAATGGGTGTACCTGAATCGATGCAAAACGTGCACTCGTGCGAGAATT
GGCTGCCAAGGAGGGTCATGAGCGCGTGGCGCGTCGCTGGAATTGTTCATGCATTGGAGGGATGGAGCGAGGATGAGTGCGGAGATACAGTGCTGGACCT
GGAGAAAGTGTGGTCTGCGGCAATTATGCATGGGTTCCGCCCTGTTGCACAACTTTGATGGTTTTGGCTGCAAGTCACTGCCATAATCTTCAGATAGCTA
TGCCATAATTAAACATGCTAAGGGAGAAAGGCACACATTACATTGGACGCCACAAAATGTAAACTCCCAGTAGGTTGATCTGCTACTATTGGCTCTTCAC
TACACTATTTATCTTCTATGCAATCACACCGACAATGAATTAATTATGTATCACTATCTGTTGGATCAATAATGTAAGTCAAT
page-top