Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig64
Contig Information
Length 520 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n11k18    rwhv16n11k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_124749 [Branchiostoma floridae] >gi|210108126|gb|EEA56040.1| hypothetical protein BRAFLDRAFT_124749 [Branchiostoma floridae]
Score 78
Evalue 3.33047
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig64
CTCTCTTCCTGTCAGTTCTCTCTGCCGGAGCGCCGTCAGCGCCATTGCCATGGCCACCGACCCTCCCCCGCCACGCCGACGAGCCCTGGAGGACCGCCGT
CGTCTACCTCACCCTTTGCGCCACCGGATTGGAGCCGGGAGTCCCCATCTCCGTCACCCACATCGTCTTTGTCTCGGGTCGTCTTCGATCCGCTCCACCC
CGAGCCTCTCCGGCATCCCCGAGCTCGCTTTTGCACGACTACAGGCCCCCATGGTGGATCCCTAGAGCCAGATGCCACCGCCGATGGATGCTACTACATG
GAGGCCACCGAAGACCAGGAGTAGTTAGAAGGTCCCAGGCAGGAGGCCTTGCCTCTTCGATCGTGTTGCTTTTATGCTAGCCTTCTTAAGGCAGTCTTGT
TTAACTTATGTATGTACTCAGATATTGTTGCTTCCGCTGACTCTTGTGTATCGAGCTTGTTTTCGAGCCCTCGAGGCCCCTAGCTTGTAATATGAAGCTT
GTATTATTTCAAAAAAAAAA
page-top