Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig60
Contig Information
Length 1475 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12k07    rwhv16n12k07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cyclin-dependent kinase B1-1; Short=CDKB1;1; Short=CDKB;1 >gi|21952860|dbj|BAC06275.1| putative cyclin-dependent kinase B1-1 [Oryza sativa Japonica Group] >gi|94467444|dbj|BAE93883.1| cyclin-dependent kinase [Oryza sativa Japonica Group]
Score 1339
Evalue 1.37355e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig60
CCCGTTTCTTTTCATCTTTTTTCCCTCTCTCTCCCCCATTTCAAAACTTCCAGATCCACCTAGGGTTTGCGCCTCCTCCCTCCGCCCCCATCACACAAGC
CGCATCGAGGAGGACGACGCCGACCTCGGACTGTCGGAAGCACCATGGAGAAGTACGAGAAGCTGGAGAAGGTCGGGGAGGGCACCTACGGCAAGGTGTA
CAAGGCGCAGGACAAGGCGACGGGCCAGGTGGTGGCGCTCAAGAAGACCCGCCTGGAGATGGACGACGAAGGGATCCCGCCCACCGCGCTCCGTGAGATC
TCCCTCCTCCGCCTCCTCTCCAGCTCCCTCTACGTCGTCCGCCTCCTCGCCGTCGAGCAGGCCACCAAGGGCGGCGGCGCCGGCAGTGGAGGGAAGCCCG
TCCTCTACCTCGTCTTCGAGTTTCTTGACACTGACCTCAAGAAGTTCGTCGACGCCTACCGCCGTGGGCCCGCCCCTAAGCCGCTCCCAACGCAGGTCGT
CAAGAGTTTCTTGTATCAGTTATGCAAAGGAATTGCACACTGCCATGGCCATGGGGTCCTTCATCGGGATTTAAAGCCCCAAAATCTATTGGTTGACAAG
GAGAAGATGATACTGAAAATTGCAGATCTTGGGTTAAGTANAGCTTTTACTGTTCCTATGAAAAGCTACACCCATGAGATCGTGACGCTTTGGTATAGAG
CTCCTGAAGTACTGCTTGGAGCAACACATTACTCAACCAGTGTTGATATTTGGTCCATCGGATGCATCTTTGCCGAGATGGTCAGAAAACAGGCTCTTTT
CCCTGGTGACTCTGAGTTACAGCAACTGCTTCACATTTTCAAGCTGTTGGGAACTCCTACCGAGGAGGATTGGCCTGGAGTAACTGCTCTGAGGGACTGG
CATGAGTTTCCTCAGTGGAAAGCACAAAGATTGACACGTGCAGTCCCTACACTGGAACCAGAAGGAATTGACCTGCTATCGAAAATGCTCCAGTTCGACC
CGGCGAACAGGATCTCAGCCAAAGCCACGCTAGAGCATCCCTATTTCAACAGCCTCGACAAGTCTCAGTTCTAGCTGTTCTAGCTACCGTGTGATTTTTC
TCAACTTGGTGTGTGCGCTCTGCTCACCAACTTGTTCTGCCATGAGATCGATGCTGAAAACGCACGAAACCATGTTTCATCTACCTACAATCAGCAACGG
CGTGTTGCTGGTAGTTGGCTCCCATGAGCGCCCGTCTCCTAAACCTCCAGCACTTGATTTGCCCTGAGAATTATCGACTGAAGATACTGTAGGAGTTTTA
TTTGCTCTGTACGGAATTGTTTGATGAGATGGGTTTGTGGACAACAGACATTTGTGTAGCATAATAAGGCAGTACTAGTATTTGTTAAGAAAATGTTGCT
TCATGACAAGTGAAGTTATTTGGAGCTGCGAAGTGGTGAGAGGCGTGGCGTGTGTCCGTGGAAGGAGCTTAATAG
page-top