Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig58
Contig Information
Length 566 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12k05    rwhv16n12k05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0765900 [Oryza sativa (japonica cultivar-group)] >gi|31415934|gb|AAP50955.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|108711254|gb|ABF99049.1| cytochrome b6f complex subunit, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549849|dbj|BAF13292.1| Os03g0765900 [Oryza sativa (japonica cultivar-group)] >gi|125545832|gb|EAY91971.1| hypothetical protein OsI_13659 [Oryza sativa Indica Group] >gi|125588031|gb|EAZ28695.1| hypothetical protein OsJ_012178 [Oryza sativa (japonica cultivar-group)]
Score 376
Evalue 1.16826e-34
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig58
GAACTCGACAACCACCGGAGGTTCAGCCGAGCTCGACCGATGGCGTCGCTCTCCGTGGCCACGCTCCCGCAGCTCGCCGGCGCGCCGGCGGCGGCGGCGG
CGAAGAAGAGGTCCGGCGTGACGTACGTGGAGGGCATGAACGCCTACAGCGGCCTCAAGGGGCTCAACAAGGTGACCATGCTGGGCGTGCGCAAGAGCGC
CGACTACAAGTTCGCCAGGATCGTGGCGTCGCTCAGCCCCGCGGGGAAGAGGCGCGGGGGCTCGTTTGGCGCGCAGTGCAACGCCGCCGGGGAGATCTTC
CAGATCGCCGTCGTCATGAACGCGCTCACGCTCGTCGGCGTCGCCGTCGGCTTCGTGCTCTCCGGGCCGAGGCGGCCTTCGAGGAGTCGGAGGAGTGAGT
GAAACCCAACCCAACGCCGTGTGCCTGCCCTGACCAGCCGTTTCAGTTCAGTTCAGTTCAGGCTGCTGTTTGGCTGGCGCGTAAGCCGTGATATATAAAA
CGTGATGTATGCTATTTTACATTTGGTTTTGTATCAATGACAATCGATTGATGAATAAAAAAAAAA
page-top