Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig55
Contig Information
Length 923 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n1e21    rwhv16n1e21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar proton-ATPase D subunit [Triticum aestivum]
Score 880
Evalue 4.32644e-108
Total Hit Count 219
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig55
GCGTGAGCTTTACAGGCTGGTTCTAGTTGATACACCCTTAGCACCGTACTTCTCAGAGTGCATTACATCTGAGGATCTGGATGACATGAATATTGAGATC
ATGAGGGAACACACTCTACAAAGCGTATCTTGAGGATTTTTACAAATTTTGTGCGAAACTAGGTGGTGCGACGGCTGAGATTATGTGTAATCTCCTTTCA
TTTGAAGCTGACAGAAGAGCTGTAAACATTACCATAAACAGTATTGGTACTGAGCTGACTAGAGATGACCGCCGGAAGCTGTACTCCAACTTTGGTCTAT
TGTTTCCGTATGGTCATGAAGAGTTGGCTGTCTGTGAAGATGTTGACCAGGTGCGTGGTGTAATGGAAAAGTACCCCCCATACCAGTCTATTTTTGCCAA
GATATCATATGGCGAAAGCCAGATGTTGGACAAGGCCTTTTATGAGGAGGAAGTAAAGAGGCTGTGCCAGTCATTTGAACAGCAGTTCCACTACGCTGTT
TTCTTCGCATACATGAGGCTACGAGAGCAGGAGATAAGGAACTTGATGTGGATCTCGGAATGCGTTGCCCAGAACCAGAAGAACAGGGTCCACGACAGCG
TTGTGCCGATCTTTTAATCGCCCCCTATTACTGTGCATATGGTTGTGCAAAAGGTCTGCTTTGATGATGGCACAATCGATTGCACACTTTACAAGCTCAT
GATTTGTTATTACCCCTGTTCCTCTTTCTATGCGGCTGAAAAGCTAGACCTGGACTAGTGTATCATTATTTGTTTTTGTAGTAAAATAAAAGGCGCAGTT
GTACGGTAAACTAAATAAATGATGTTTATTTTCGTAGTGGGTGGCACTATTTGTGCAGTTTGTTGGCAATGTAAAATGTACACCCAAGATATCAAATGGT
TTGTTGGCAAAACAAACTCTTTT
page-top