Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig54
Contig Information
Length 985 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12j19    rwhv16n12j19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit F-box domain containing protein [Zea mays]
Score 225
Evalue 1.14463e-16
Total Hit Count 46
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig54
CCCTCACCTGCCCCGCCTTCCTCCGAGCCGTCCGCTCGTCCCCCTCGTTCCGCCGCCGCTTCCGCGACCTCCACCCGGCCCCGCTCCTGGGCGTCTTCCT
CGACATCTACGACTCCGCCATGCCCGCCTTCGTGCCTAACCGCCACTGGTCCGATCCAGACCACACCGCCGCCGTCCGCGGCGCCGACGTCTTCCTCACC
CGCGTCCCCGACGTTGAAGACGAAGGGTCCGACGACCCGGACCATGCCGCTGCCGTCCGCGGCGCCGACGTTTCCCTCACACGTGTACACGAAGACGAAA
GCGAAGGCGGCGACGGCGACGGCGACGAAGAAAGTGAATTCGAAGGCGGATACAAAAGCCCCGGGTGGTCGATGACCTCGTGCCGCGACGGGTACGTGGT
TCTCGTCAGCCGGAGCACCAAGCGGGCGGCCGTCTACGACCCGCTCACACGGCGCCTGCATCTCCTCCGCGCGCCGCCCGTTGAGACCCGCGAAGACGCC
GAACCTGAGTTCGTCGTGGTCACCCCCGAAGAGGACCCCCGGTCGTTCCGCGTCGTGTGCATCTCCAAGGAAATGAGGGCAGCGCAGGTCGCCGTCTTCT
CGCCGGGCAGCATGGAGTGGCAGATCTTCCCGAAGGTGGGGAACCTGAAGCAGTTCCTTGTATACAATGGCCCAATTGTGAATTCTGGACTCGAAGGGGC
TTTGACGAAGAGGAATAAAGATTAGAACTCGGGCGATTTTATCACCGGAGAGTGAAAGGCTCCGTCGCTCAGAGCTGCTGGGGTTGCTGCAGATTGCACC
TACGAAGTGCTGTACTAGAGACTTGGAGCTGCTGTTCTTTAGCACCTCCTAGTTGGCTAGTTACAATAATGGGTACTGCTATTTGCGCAATTGCGCTTAC
TTCTTGGCTACTTCATGTCATGCGCCTATCAGTTGTGTGAACTGTCATGTTATTAATCTTACGTTTGTGATGTCAGCTGTCCACT
page-top