Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig44
Contig Information
Length 1114 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3c14    rwhv16n3c14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0244800 [Oryza sativa (japonica cultivar-group)] >gi|108864188|gb|ABA92392.2| PHD finger protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113644821|dbj|BAF27962.1| Os11g0244800 [Oryza sativa (japonica cultivar-group)] >gi|215737030|dbj|BAG95959.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218185517|gb|EEC67944.1| hypothetical protein OsI_35671 [Oryza sativa Indica Group]
Score 672
Evalue 9.9209e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig44
CCCGGAGCTCAGGCGACGCTCGCGCCTCCAAATGGACGGGGGAGGCACGCATCGCACGCCGGAGGACGTGTTCAGGGATTTCCGCGCGCGGCGGGCCGGC
ATGATTAAGGCGCTCACCACCGATGTGGAGAAGTTCTACCAGCAGTGCGACCCAGAGAAAGAGAATCTATGTCTGTATGGTCTTCCCAATGAAACATGGG
AAGTGAACTTGCCTGCAGAGGAGGTTCCCCCAGAACTTCCAGAGCCGGCACTGGGAATTAATTTTGCTCGGGATGGGATGGATGAGAAAGATTGGTTGTC
ACTTGTTTGCGGTGCACAGTGATGCCTGGTTGCTAGCAGTAGCCTTCTACTTTGGAGCAAGATTCGGGTTTGACAAAGAATCCAGGAAGCGGCTTTTTAG
CATGATAAACAACCTCCCCACCATATATGAGGTTGTCACCGGAACTGCGAAGAAGCAGGTCAAAGAAAAACACCCCAAAAGCAGCAGCAAGATAAATAAA
TCTGGCACTAAGCCATCTCGCCAGCCAGAACCTAACTCAAGGGGTCCAAAGATGCCACCACCTCCGAAGGATGAGGACGACAGTGGAGGCGAGGAAGAAG
AGGGAGAAGAACATGAAAAGGCATTATGTGGTGCGTGTAACGATAACTATGGACAGGATGAATTCTGGATCTGCTGTGATGCTTGTGAGACATGGTTCCA
CGGTAAGTGTGTGAAGATCACCCCTGCCAAAGCTGAGCACATCAAGCACTACAAATGCCCGAATTGCAGCAGCAGTAGCAAGAGGGCCAGAGCATGATAT
CGGATTCCTCCACGGCTCATGTCTGAAGATCCAAGGATTTGACTTACTGTAAAGATGCATGTGGGACGGAATGCCCAATGGATGTGCATTCAGTTGTTGC
TTTGAGATTAGTACCAGCCTTAGGGGTCTTGCTGTGTTGTTATTTGGTGTATGTCGGTGATGTTCTAGATTTACTTGTAGTCTTAGCAACTAATTGTAAC
AGCTTGTATGTCTTGGAGCCTTGTCAGTGCGCCTGTTCTGGACTCTCAGTGTCCTAGGTCCAGTGATGTATCACGCCATCATGTACCCTTGTTGTAATTT
GTTGAAGAATCGCC
page-top