Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig43
Contig Information
Length 779 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3c23    rwhv16n3c23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0300200 [Oryza sativa (japonica cultivar-group)] >gi|14495217|dbj|BAB60936.1| putative ATP citrate lyase a-subunit [Oryza sativa Japonica Group] >gi|15623805|dbj|BAB67865.1| putative ATP citrate lyase a-subunit [Oryza sativa Japonica Group] >gi|113532348|dbj|BAF04731.1| Os01g0300200 [Oryza sativa (japonica cultivar-group)] >gi|125525538|gb|EAY73652.1| hypothetical protein OsI_01541 [Oryza sativa Indica Group] >gi|125570053|gb|EAZ11568.1| hypothetical protein OsJ_001393 [Oryza sativa (japonica cultivar-group)]
Score 888
Evalue 1.01416e-93
Total Hit Count 390
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig43
TATCCGGTGCTCACAATTCTATAGTTACTGCTAGGGCTGGCAAGGACCTTGTTTCCAGCTTGGTATCTGGATTATTGACAATTGGCCCCCGATTTGGTGG
TGCAATTGATGACGCTGCTCGGTACTTCAAAGATGCATATGATAGGGGTCTTACGCCTTATGAATTTGTTGAGGGCATGAAAAAGAAGGGAATCCGTGTC
CCTGGGATTGGTCACAGGATCAAAAGCAGAGACAACAGGGACAAGAGAGTGCAGCTTTTACAGAAATATGCTCACACACACTTCCCTTCAGTCAAGTACA
TGGAGTACGCTGTTCAGGTTGAGACCTACACCCTGTCAAAGGCCAACAATTTGGTTATGAACGTTGACGGTGCGATTGGCTCGCTTTTCTTGGATCTTCT
TTCTGGGAGTGGAATGTTCAGCAAGCAAGAGATCGATGAGATTGTAGAGATTGGGTATCTTAATGGACTCTTTGTGCTTGCACGTTCAATTGGCCTAATT
GGCCACACCTTTGATCAGAAGAGGCTCAAGCAACCACTCTACCGTCATCCTTGGGAGGATGTCCTCTACACCAAGTGAGGCCGACTCAGCACGGCATCAT
ATGGATCTTCCACTTGTGTGTACACCATAAAATCGAGCATAATTGCATAGAATTCAAAGTTCTGATTGTCAACTAGGCGAGGAGGGAGAGAAGACCGTTA
CAGATGAGCATTGGCTGTGTGTATGTCTTGTGGGACTGGTGTGTTTTTTATAAGCTCCAACGTAAGTCTTTTTTTTTTG
page-top