Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig40
Contig Information
Length 1049 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12i01    rwhv16n12i01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit dual specificity protein phosphatase Diacylglycerol kinase, catalytic region [Zea mays]
Score 1017
Evalue 4.62946e-121
Total Hit Count 248
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig40
GTCTCCCGTCGGCCGTCGCGATCCCTACACCCCCCGCCGCTGCTGGGATCAGAGGTTCATCAGTTGAAGGCTTGCGAAGATGGGTTGGGGGATATCCCGG
TTGATTGGACTGAAGGCAGCTGTCTTGCTCACCGCAGCGTATTTCGTTCATGGACAGGGCATGAAAGTGCTCTCACTGCCCCTCATATACACCTGCCTGA
TTGCCGTGCTTATCTCCATTGCTTCCCATCCGTCGGTCGACCTCCCATTGCTCCTCGGCAAGGCATCCAATGGAAGCTTTCCCCTATGGTCATGGGTCAT
GTTCTCGCCCTTTCTCTTTTTCATCCATCTGTTTGTGCTTTTGCGGAGGTTTGTGAAAAATGAGCCCTTGTACACCGAGATAGCAGACGGAGTTTATGTT
GGAGGCTGGCCTTCTTCAGTTGAACGCCTGCCACCTGGTGAACCCGCAGTCATCGATTGCACTTGCGAGCTGCCAAGAAGCTCAACTATATCCGAGAATT
CATATTTGTGTGTCGCTACATGGGATACAAGGGCGCCTCAGCCACCACAGATTGAGTCAGCTGTGCGGTGGGCCGTGAGAAAGCGGTCACAGAACAAACC
TGTGTATGTCCACTGTGCCTATGGCCATGGCAGAAGTGTCTGCGTGATGTGTGCACTTCTAGTCGCACTGGGATTAGCTGACGATTGGAAAGCTGCTGAG
CAAATGATCCGCGAGAAGCGGCCTTCTATCAGCATGAAACACTCTTCATCGCAAAAGCTTAGAGGAATGGTCGAAACACTTGCTTGCTCCCTCAAAAGGA
AGTGGGGAATCCGATGTGAGTTCTGTGATTCTTTCGGACTACACCCGGAAAAAGCATTGAACTTGCGAGACACGGACTTGTTCAGTAACTGTGATACTTG
AGAAGACTTCATGCTTTGGTGTTATCTACTGTTGTCCTAGTAAATGTCCAAGGCATTTCGTTGTCTAAGTTACTGTCCTCGATTATGTTGTATGGATACG
TGGGTATTCTATTACTGTGGCTTACAATGTTGCTCTTTTTATGCATACT
page-top