Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig39
Contig Information
Length 619 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3d10    rwhv16n3d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HAP3 [Oryza sativa Japonica Group]
Score 508
Evalue 7.12413e-50
Total Hit Count 473
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig39
AGGAGACCCTCCAGGAGTGCGTCTCCGAGTTCATCTCCTTCGTCACCAGCGAGGCCANCGACTAGTGCCAGAAGGAGAAGCGCAAGACCATCAACGGGGA
CGATCTGCTCTGGGCCATGGCCACGCTCGGATTCGAGGAGTACGTAGACCCCCTCAAGATCTACCTGCAAAAGTACAGAGATATGGAGGGTGATAGTAAA
TTGACCTCNAAATCTGGTGAAGGATCCGTGAAGAAAGATATAATTGGTGCTCATAGTGGTGCGACTAGCTCAAACGCCCAAGCGATGGTTCAGCATGGAG
CTTACGCCCAAGGGATGGGTTATATGCAACCCCAGTACCATAATGGGGACACCTGAAACTGAAGATCAGGCAATTTTCGGCAATGGGTATTGCTCCATGA
GTGGTTATCTATCTGTTAAGGAAGCCGCCCCAACATTAGGTTCATGATGATCATTGGCTGGAAACTAAAGCACCTGGAAGGGTGCTTAACAGTTGGTTGT
GATGGCTGCCTCCAAGATGTAAATTGCTTCCGAGAGAATAGATTCACCTATTATGGTTTAGTGCTTGTTTTTATCTGTACATTCAGAATAATTCAGCCGT
TGGTAGTTTGGCAATCTTT
page-top