Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig38
Contig Information
Length 527 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n11o13    rwhv16n11o13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 339
Evalue 1.83991e-30
Total Hit Count 37
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig38
TGGTGACCTGCTTTCCCGACACAGATCTGAGCACCGCTAAGGTGCTCATGGAAGTCAAAGGTATCAAGCAACTTCCAGTGGTCAAAAGGGGGGCTGGTCG
TAGGAATGATGGGAGGCGTAAAGTTCTCGGGCTTCTTCATTACGAGTCAATAGGACGATGCTTAAGGGAGGAGCTGGAGCGGTGGAAGGCGATTTATCAG
AGAGAATTCCCAGCAGCCAGCAGTTAGCTGGCAGTGAGCATGGAGGCACCGAACATGCAGAGCTGAAGTTTTGGTTGTAATTTTTAGTGAAGAACATACC
AAATACATAAAGGGACGTTTCAACAAACTTAGGGATTTAGGGTTAACTTGAACACCTCAGTTAAAAGAGTCACCAAATGTAAAGTGTTTTGGAGCTTGCC
AGGATATACATTTCGTATGGATTACAGATTATAAGAGGTGATGGTGTGGTTTCAGCTTTGATGTTTCTGGGTTCTGACCATGGTAATATACTGGGAACAT
ATTGCTTGGCCTTTTGCAAAAAAAAAA
page-top