Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig37
Contig Information
Length 831 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3d17    rwhv16n3d17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative LHY protein [Oryza sativa Japonica Group]
Score 448
Evalue 6.41589e-84
Total Hit Count 153
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig37
ACTGCCCAGTGGACAACGCACCGAAGGAATGCCAAGTAGCTCAGGAGCAAGGTCAACCTGAAGCTATGATAGTTGGTGCGTCTTCTGGATCAGACGAGAG
TGGAAAAGGAGAGGTGTCTCCCCACACTGATAAAGTTGAGACAACACCTCCCACAGGAGCTGAAACAAGTGATGCTTTCGGCAACAAGAAGAAGCAGGAT
CGCTCTTCATGTGGTTCCAACACGCCATCAAGTAGTGATGTAGAGGCAGAACATGTTCCTGAGAACCAAGATCAAGCCAACGACAAGACACAGCAAGCAT
GTTGCAGTAATTCTTCAGCTGGTGACATGAACCACCGCAGGGTCGTATGGCTTTCGATAAACTGTTCAGTAGAGGAAAGCTTCCCCAAAGCTTTTCTCCT
CCACAAGCAGAAGGATTGAAGGTGGTACCCAGGGGGGAACAAGACGAAGCTACTACGGTGACGGTCGACCTCAACAAGAGTGCTGCAGTTATAGACCATG
AACTTGATACATTGGTTGGGCCAAGAGCTGCTACCTTTCCCATTGAATTGTCACACCTGAATATGAAATCCCGCCGGACAGGCTTCAAACCTTACAAGAG
GTGCTCGGTGGAAGCAAAGGAGAATAGGGTGCCGGCTGCTGACGAGGTTGGTACCAAGAGGATTCGCCTTGACAGCGAACCCTCCACGTGATTTACTTGC
CACGACATGATTACCAGCCTGCACGAGTAGTGTATTTTCAAGAAATTGCAGTATTTACATCTAAGCTACTACTATAGGACTTCTCAGTCCTTGCAATGCA
GTGTTTCCACAGAACTCAATTTATTATGTGT
page-top