Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig36
Contig Information
Length 1269 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3e03    rwhv16n3e03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0134200 [Oryza sativa (japonica cultivar-group)] >gi|113648601|dbj|BAF29113.1| Os12g0134200 [Oryza sativa (japonica cultivar-group)]
Score 1362
Evalue 2.39733e-148
Total Hit Count 103
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig36
CAGTTCTTATTAAATCGTACTTGAGCAATGCAGCAGATGTTATTAGTGGATACAATGCAGTGGTTATCCCTGTAATTTTTTCTTCAAGATTTGATGATGA
TAAAGAGACCAGTGCCTTGTATGGAGAACTTTGGGAGGATATTCCTAGCAGTGAAAAAGTAACCCTTCAGCTTTATTTACCAGAAATTGTATCCCTTTTG
TGCGATTGCATGTCCTCATCATCATGGGCTGGCAAGAGAAAGTCAGCCAAGGCTACAAAAAGTCTATGTGATGCCCTTGGAGAACCTGTTTCTGCGCACC
ACCATAATATTCTCAAATCACTTCTGAAAGAACTACCAGGTCGATTTTGGGAGGGAAAAGATGCTGTTCTGGATGCACTAGCTTCACTGTGTTTGTGCTG
CCACGCTGCTATAACCGCAGATGAACCCACTATGCCTAGTGTTATTCTGAATGCTGTTTGTGCTGCATGCAGTAGGAAGCCGAAATTGTACCGTGAAGCA
GCTTTCTCGTGTTTACAACAAGTGATCACTGCATTCAAAGATCCAGGATTCTTCAATAGTGTTTTCCCTATGTTGTATGAGGTTTCTAATCAGTCTGTCA
TTTTTAAGACAACAAGGAGTTCATCTTCACTAAGTACATCTGCTGCTGCTGAGCAAGATGAAAGTGCAAGTGTCTCCGTTTCTCTCCACAAGGTGCTCAA
CTGTGCTGCATCTAGCATCACTATTGCTTTGCCACAAGATATTATCCACCAAAAGAAGAATATGTTAGAGGTTCTGTTGAACTCTCTTTCACCCGAGGAG
GGTTGGCAAGTTAAATTGTCATCCTTCTTGTGTATCAAAGAATTGTGCTACAAATTTTCGGATTCTGGTGGTAGCACGGCGTGGCCTGAAGGCACAGATG
ATTTTGTTCAGGAGATGTTTCATTCAGTGGCGTCAAAAGTAGTAGACTCCATACGCTTAGTTAAGATTGCTCAGGTTCATGTTGCTGCTTCAGAGTGCCT
TCTTGAGTTGATCAAATTGTATAGAGACTTCCCGTTGGAAGAGAGAAGAGAGGCCAAGTTTGAGGGTGAACTAATCCAACTCTGCGAGTCAGAAAAAAGT
GAACAGGCAAAGGCACTTTTGAAGCAATGCTTGGCTGCTCTCAAAGAGCTCACTGGCGTAACCATGACGATAGGTTAGATGTACACTTTTTCGATACATG
TAAAATCTGCTACATGAAAATGCTGCCAGTGGCACACTTGAAATTTATGGCAAAGTGGTTGCATGCACG
page-top