Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig35
Contig Information
Length 995 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3e12    rwhv16n3e12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195644980|gb|ACG41958.1| rab GDP dissociation inhibitor alpha [Zea mays]
Score 1223
Evalue 2.20246e-132
Total Hit Count 420
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig35
GCGCTTGCTCTTCACAGGGATGATCGCTACCTAAGCGAGCCAGCAATTGACACTGTTAAAAGAATGAAACTCTATTCTGAGTCTCTTGCACGGTTCCAAG
GAGGCTCACCTTATATTTACCCATTGTATGGGTTGGGTGAGCTGCCACAGGCTTTTGCACGTCTAAGTGCTGTTTATGGTGGCACTTATATGTTAAATAA
GCCAGAGTGCAAGGTTGAATTTGATATGGAGGGGAAAGTGTGTGGTGTTACATCAGAAGGTGAAACTGCTAAGTGCAAGAAGGTTGTCTGTGATCCTTCT
TACTTGGCCAACAAGGTAAGGAAGATTGGAAAAGTTGCACGAGCAATTGCTATTATGAGCCACCCAATTCCAAATGCAAATGATTCCCACTCGATTCAGA
TTATTTTACCACAAAAGCAACTTGGGCGCAAGTCAGACATGTATGTCTTCTGTTGCTCGTACACTCACAATGTCGCGCCAAAAGGGAAGTTCATTGCATT
TGTGTCTGCCGAAGCGGAGACTGATAATCCACAGTCCGAACTAAAGCCTGGAATTGATCTACTTGGTCCAGTAGATGAATTGTTTTTCGATATGTATGAC
AGATATGAACCAGTCAATGAACCTTCTCTTGATAATTGCTTTGTCTCATCGAGTTATGATGCCACTACTCACTTTGAGACGACTGTGACAGATGTTCTTA
ATATGTACACACTGATTACTGGAAAGACTGTTGATCTTAGCGTTGATCTCAGTGCTGCCAGCGCTGCAGAAGAGTACTAGATCTCAAACCCAGAATTTTC
TTCAAGACATACTTCCTGGAGGACGAGGAACACCACCGGAATCCTACTGTGTGATGGTCACGTGTGACATCAGCTGCGTACTGCGTAGGGTTCCAGGTCC
ACGCCTGCTACCAGCACTATGCGAAATTATTATCTTTGGAATGGTGCTGGGTTCCTTCGTTAACTTCCATATTGATCCACTGGGTGTAAACGTAT
page-top