Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig33
Contig Information
Length 945 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3f20    whv16n4h02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NADPH producing dehydrogenase of the oxidative pentose phosphate pathway [Zea mays] >gi|3342800|gb|AAC27702.1| putative cytosolic 6-phosphogluconate dehydrogenase [Zea mays]
Score 1286
Evalue 9.9595e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig33
TCTCCCCCTCCCGAATCTCCCTCCTTCCTCTCCCCCCCTCGTTCGTTCCTTCGCTCGCTCGCACCCCGATCTCCGTCGCAGCCCGGGCGTGGCTTCCGGC
GGGGCGGGCGGAGGAATCGAGGCGATACCGGCGAGGTACAAGATGGCTCTCACCAGAATTGGTCTTGCTGGCCTCGCCGTCATGGGGCAGAACCTTGCCC
TCAACATTGCGGAGAAAGGCTTCCCCATCTCCGTCTACAACAGGACCACCTCCAAGGTCGATGAGACCGTTCAGCGCGCCAAGCTAGAAGGAAACCTTCC
TCTCTACGGTTTCCATGACCCTGCATCCTTCGTCAACTCCATTCAGAAGCCACGTGTCGTCATCATGCTTGTCAAGGCCGGCGCTCCGGTTGACCAGACT
ATCGCCACGCTCGCAGCACACCTGGAGCAGGGTGACTGCATCGTTGATGGAGGAAACGAGTGGTACGAGAACACGGAAAGGAGGGAGAAGGCGATGGAGG
AGCGTGGACTCCTCTACCTCGGGATGGGTGTTTCCGGAGGAGAGGAGGGTGCCCGCCATGGCCCCTCCATGATGCCTGGAGGCTCGCTGGAGGCATACCA
GTACATTGAAGACATTCTTCTCAAGGTGTCTGCTCAGGTCCCTGACAGTGGCCCGTGTGTCACATACATTGGGAAGGGTGGATCCGGAAACTTTGTCAAG
ATGGTTCACAATGGCATTGAGTATGGTGACATGCAACTCATTGCTGAGGCGTACGACGTTCTCAAGTCGGTTGGGAAGCTCACAAACGGTGAGCTGCAGC
AGGTTTTCGCCGAGTGGAACAAGGGTGAACTCCTCANTTTCTTGGTTGANATCACTGCTGATATCTTCANCATCAAGGATGACCANGGTGAGGGCTACTT
GGTCNACAAGGTCCTGGACAANACCGGGATGAAGGGAACCGGGAA
page-top