Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig29
Contig Information
Length 1197 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12g13    rwhv16n12g13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_30065 [Oryza sativa Indica Group]
Score 1325
Evalue 4.32062e-144
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig29
AGAGAGCACTAACCCAGTACTTCGGGCTCGGTTCCGAGACTCGCCACACCGCCACATGGGTTCCTGATCCTTATGGAATTGAGACCGGCAACCAAGAGAA
GGCCCCTGAAGGCTATGAGGAGAAATGGCTGCTCAATATTCATGCCATCGACACGAGGGGCGTGGCCGACAAGCCTAGCTGCACCGAGTGCAAGTGCGAC
TTCTACAATGTCACAATTGATGAGTATGGGCGCACAGTCTCGAAGAACTACACTGGTGGGTTGCTTTGCTGCTATGATCAGACCCAGTGTCGGCTCAAAG
CAGGGTTCAACGCCGAGGTGCGGAAGGTGTTCTTGCAGTACACCGTGACTTGGCTCGACTGGACTGATGCGGTGGTGCCTGTCAAGATCTACATATTTGA
CGTTACGGATACCGCTATGCTCGACGGGACTCATGAACACTCTTGCAAGGTTGAGTATCAAGTTGAGGAATGCAGCGCGGAAAACCGAGCCAACAATGAG
TGCATCCATACTAAGACTACCAGAGCGGTCTTGCCGCGTGGAGGAGATATCGTGTACAGTGTTGCACACCAGCACTCTGGAGGAGTCGGTGCTTCTCTGC
ATGGCCAGGATGGACGCCTTCTATGTGAATCGCTTCCAACTTACGGCACAGGGAAGGAGGCAGGGAACGAGGCAAACTACATTGTCGGCATGTCGAGTTG
CTACCCTAAGCCAGGATCCATCAAGGTCAGCGACGGCGAGGTGCTGACCATCGTCTCCAACTACAGCAGCGACCGAGAGCACACCGGCGTCATGGGCCTG
GTCTACATCCTCGTGGCCGAGCCGCAGCAGCCGGCTCCGGCGCCATCCCTGTGCTTCAGTTTTCCGGCCCCATGGTGCCTACCGGCATGGATGTCTAGCA
ACATGTGAAGAGTAGATTATCATCTACCTGCAATACAAATGGTGAGGCCAGAAGAAGCTGAACCAATCACCCTGGATCAATCATCGTCATAGTTATAAGA
TGGATGTGTTTTTGTCATACTATTACTAGCTAATATACAGAAGCAGTCACCGGTCAGTGAGCAATGTCATTTCGATGGACCATCAGTTTCTGATGCTTTG
TAATTAGTTATTATCAGTAGTAGTGTATGAAGCTGAGTTGTATGAGTTGATCACCGCCATAAGAAAAACTAGAGTCGATATAATAGTAAGGAGAAGT
page-top