Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig26
Contig Information
Length 752 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3j05    rwhv16n3j05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0190200 [Oryza sativa (japonica cultivar-group)] >gi|108862277|gb|ABA96031.2| thylakoid lumenal 29.8 kDa protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113648847|dbj|BAF29359.1| Os12g0190200 [Oryza sativa (japonica cultivar-group)] >gi|215765642|dbj|BAG87339.1| unnamed protein product [Oryza sativa Japonica Group]
Score 916
Evalue 5.33827e-97
Total Hit Count 141
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig26
AGCCTGTGGAGTTTCGGTGCTTGGTTTTGCAGGCGATGGCCTGGCGGCGGCCAAGCAGGGCCCGCTGGCAGGGAGGATCCCGGGGCTGTCTGGCCCTGAT
CAGAATGGTTGGAAAACATACCGCAGGCCGGACGAAAAGTCTGGCGGCCACGGAGTCGGCTGGAGCCCGATCATCCCGTATAGCTTCAAAGTTCCTGATG
GCTGGGAAGAGACACCAGTGTCGATTGCTGATCTTGGTGGGACGGAGATCGACCTGCGGTTCGGAAACCCCAAGGAGGGCCGATTATCTGTCATCGTAGC
GCCCACTCGTAGGTTTGCAGATGACCTTGACGATGCAACAATCGAGAAGATCGGCACGCCGGAGAAGGTGATCAACGCCTTTGGACCGGAGGTCATCGGC
GAGAATGTGGAAGGGAAGGTTCTGTCCACAGCCACAGCTGAGTACTCCGGAAGAACTTACTACCAGTTCGAGCTGGAACCACCTCACATCTTCATCACGG
CTACGGCTGCTGGGAATAGACTCTACCTGTTCAGCGTAACTGCAAACGGGCTACAATGGAAGAGGCATTACAAGGATCTGAAGCAAATAGCAGAATCATT
CCGCGTAGTCTAGGGTGGTTCCACTGGGTTCGTTCATCACGTAATCTGTTTATTATTAGAGAAAATGAGGGATGCCGTTATGTAAAGGGAGGGTAAGTAC
ACATCATTTGTAACGATGATTATTTANCTGAANAAATTGAACATTGTATGTA
page-top