Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig23
Contig Information
Length 888 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3k18    rwhv16n3k18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32701 [Oryza sativa Indica Group]
Score 1031
Evalue 3.35668e-110
Total Hit Count 137
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig23
AGCCTCGCCAGCCCAACCCATTCGCCGCTCCCCTGATCCATCCGGCGACGCGGCGGAGCAAGGAAGGAACCAAGGCTCGAGCAGCGGGCGGCCGGAGAGA
TGGCGGAGAACCCGCAGCTGTTCGGGAACGGGATGCCCGTGCCCTTCCACGGCGAGATGTTCGTCCTCGCCCGCGACGGCGTCGAGTTCCACGTCGACAA
GATCCCCTCGGCGCCCGGCGGTCACGCAAAAACAAAGGGCACCATATACCTTTCTAACATAAGGATGGTGTTTGTCGCTGCCAAGCCTGTTGGCAACTTC
TTTGCCTTTGATATGCCCCTGCTGTACGTGCACGGTGAGAAGTTCAACCAACCGATATTTCACTGCAACAATATTTCTGGGTTCGTTGAGCCGGTTGTTC
CAGAGAGCCAGAACAGGGCTCTGTACTCGACCCACACCTTCAAGATCTTGTTCAAGGAAGGTGGATGCGGTACCTTTGTGCCACTCTTCCTGAACCTGAT
CACATCAGTGCGGCGCTACAATCAGTTTGAAGCCCAGCCCGCTACTGTGCCCCGTGTGGACCCCATGCAGGCAGCGCAGACTCCTGTCGATGACATGATG
CGCCATGCGTACGTCGATCCACATGATCCTACCAAGATCTTCCTCCAGCAGCCCGCAGCGGAATCCCAGCTGAGGAGGAGAAACTACCACGGCCCCGCTG
ACAACGCGTACTGATGCTTTGGCCTGATTGCAAAGTGCATGTGTTTTCGACGAGCTATGTATGTGGTGCACATGAGCAATATATCTGTTTGGTGTCATTC
CAGTGACTCTCACTGAAGAAAATGTGATGGAAGTATAGTAGTATGATGATGATGTTAGACAATTGTGGGTTCAATCTAGATCTAAGTA
page-top