Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig20
Contig Information
Length 473 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3l23    rwhv16n3l23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit LmbE family protein [Mycobacterium gilvum PYR-GCK] >gi|145213112|gb|ABP42516.1| LmbE family protein [Mycobacterium gilvum PYR-GCK]
Score 83
Evalue 0.712837
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig20
CCTCGTGCCGGTCGACAACAGACTCATCTTAAGACAACCTCCTGTAGAGAATACATCATACTGGTGTATCACCTGGTCTGTGCAACCAATGCCAGAACCA
TACACATAGAAGAAGAAGCATTGTTTCGCGGCATTGCCCGTCTAGTGCCAGCCCCATCCCTGGGCCTTCGCCGCTTTACCATTCTACCAAGATTCAATTC
ATCTCTTGAATCGTCAGCTACTAGTGTATTGCTGTGAACAGCGTTGCTTGATTACCTGGAGATCTGTCTTAAATCTGTAATACAGACCATTACTCTGTGT
ATCACCGTGGATGAAGCCCAGCACATGCTATATTCCCCAGGAGTTGAATTCTGACCTACTGTAATCCATGGGAATTGTGTGTACGCTGCTGTTGTCAGGT
CCCTGATTGTATCATCCTCACAATTTGAGAGAAGTTTATTAGATTTTTACACCAAATTTTTTGAAAAAAAAAA
page-top