Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig11
Contig Information
Length 877 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12e03    rwhv16n12e03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative casein kinase [Oryza sativa (japonica cultivar-group)] >gi|55733867|gb|AAV59374.1| putative casein kinase [Oryza sativa (japonica cultivar-group)] >gi|125593152|gb|EAZ33211.1| hypothetical protein OsJ_016694 [Oryza sativa (japonica cultivar-group)]
Score 527
Evalue 1.36102e-54
Total Hit Count 69
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig11
GATAAACAAGAAGTGGAAGGAGGGGTTTTACGTCACAGTCTATGGCCACTGCAGGAAGCCGATGGGCAGTGGTCGTGTCCCGTAATGCTGGCTTTGTAGA
TCAGGTCGTGGAGCTTGACTTCTTGTATCCAAGTGAGGGAGTTCACCGGCGTTGGGATAATGGTTATCGCATCACTGCTACTGCTGCTACATGGGACCAG
ACAGCACTTATCTTGAGCATCCCCAGAAGAAAGCCTGCTGATGAAACGCAGGAAACCCTAAGAACATCTGCTTTCCCGAGCCAGCATGTGAAGGAGAAAT
GGGCAAAAAATCTCTACTTGGCCTCCATTTGTTATGGAAGAACGGTATCATAAGTTCCATTTTGTTTGGCTAGCATGTAGAGTTTATTTAACGACTTTCA
GGTTTGCGATTAGATGATGGAGTTTTGAAGGGCAATGGTATTCCTAATTCACTCATAATTAATAGAGTTGATAGATCATAGATGGCAAAGCTGCTGTGTT
TTCTGTTTACATAGGTTATATAAGAGTGTATGTTGTGGTGATGTGTTGTTGTATTCTCTTGTCCATAGAATGTCAAAAATTGGTGTGATCTAAATGTAGC
CCATCATGCATATAGTTCAAANTAGATATTTTGCCCTTGAGGTAGGCAGCAAAACCTGTACAAACTTAGAGCTGTGCCTGGGTGGCCGGACTCTACTGCA
TCACAGTTTCTGCGATCTCCTGTGATGTCTCAGGATGNGTTCGATTGCGAGTATGATGAGCTCATTCTTGGATGGAGCTGGTCACTACGTGATTATCTTC
GTAGGTGTATNCTGATGTGNGCTATTCTACTTACGTTGCACTCGNNGCCTTCCTATGCTTCNGCTTCTCGATGTAAA
page-top