Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig9
Contig Information
Length 1486 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n3p12    rwhv16n3p12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195627750|gb|ACG35705.1| 26S proteasome non-ATPase regulatory subunit 13 [Zea mays]
Score 1605
Evalue 1.98741e-176
Total Hit Count 241
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig9
CCGCTTCCGTTCCACGGCAAGTATCCGTCGCACGATTCAGGCCCACCCCTCGACGTCGTCCATGGCGCTGCAGTACGTGGAGGCGCAGCGGCAGGCGCGG
CCGGACCTCGCCGACTGGTACGCCGACCTCGCCGACCTCTACCAGCGCAAGCTCTGGCACCAGCTCACCCTCAAGCTCGACCAATTCCTCCAGATCCCGG
CCGCACAGACTGGCGACACGCTCATACAGCTCTACAACAATTTCATCTCCGATTTCGAAACAAAAATCAATTTGCTCAAACTCGCCCAGTTCGCGGTCAT
AGGGTCGCGCCAATATCCCGACAAGGATGCCGCCATCACCTTCCTCGAGGGGATAATCACAAAGCTTCGTGAGACCAGGGAGCTGCGGATCAATGAGCCT
ATCCTTCACGTCAAGATGCAGATCGCGGCAATTCACCTCGACAAAGGGAACCACAAGGAGTGCAAGAACCTGCTGGAGGAAGGGAAGACCACCCTGGATG
GCATGACTGATGTGGATCCAACAGTCCACGCTAGCTTCTACTGGATATCGTCTCAGTACCATAAGTCGCTCCAAGAGTTTGCTGAGTTCTATAAGAACGC
ACTTCTCTATCTGGCCTACACAACCGTAGGGTCCCTCTCAGAGTCATTCAAGCTGGACTTGGCATTTTGACCTTTCCCTTGCAGCCTTGCTGGGGGACAA
CATCTACAACTTCGGGGAATTGTTTAGCTCACCCCTATTATCAATAGTCTTATTGGGACCAAGGTGGAGTGGGTCTATCACATGTTACAAGCGTTCAACA
CCGGCAACCTAGCTCTCTACCAAGAGCTTTGTGGGGTTCACAATGCTGCTCTTAGTGCACAGCCTGCATTGGTGCAGAATGAACAGAAACTGCTTGAGAA
GATCAATATTCTGTGTCTGATGGAGATAATCTTCAGCCGGCCATCAGAAGATAGAACTATCCCATTAAGTGTTATTGCCAAGCAGACTAAGCTTTCAACC
AGCAAAGTGGAATGTCTTCTTATGAAGAGCCTCTCGGTTCATCTCATAGAAGGAATCATCGATGAAGTTGACAGCACGGTTCATGTTTCGTGGGTCCAGC
CTAGAGTACTTGGCATCCCACAGGTGAAGGCGTTGCGTGAGCGCCTGGACTCGTGGGTAGGCAAAGTGCATACCACGCTGTTGTCCATCGAGGCAGAGAC
CCCCGATCTCGTGGCGGCTTAGCTTCTTGGCCGAAAATGATTCTGAATAGGCTTTGGTTGTCAGCAAGGCGGCGGTGTAAAACGAGAGACCATCTGGCTG
TGCTGCGCGTGCTAGCTGCTCTTTTCTTGATAACGAAAACTTGTTGCCTTGGGTGTCCTATTGGTCTGGACTTGTAACTTGCTTCTATCATCACGGATCG
AAACAGAGAAATCATACCGGCAGAGGGCGTCACTAGCTTTTTCCTGTTGAACTTTATAATCTGTAATCCAGCGGTTTGGCATTTTT
page-top