Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig8
Contig Information
Length 775 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12d06    rwhv16n12d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0939700 [Oryza sativa (japonica cultivar-group)] >gi|57900400|dbj|BAD87610.1| putative S-formylglutathione hydrolase [Oryza sativa Japonica Group] >gi|113534882|dbj|BAF07265.1| Os01g0939700 [Oryza sativa (japonica cultivar-group)] >gi|215697853|dbj|BAG92046.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765440|dbj|BAG87137.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1009
Evalue 9.37396e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig8
CGCGCCGCCGCGGCCCACGGCGTCGCCCTCGTCGCCCCCGACACCTCCCCGCGTGGACTAAATGTAGAAGGAGAGGCAGATAGTTGGGATTTTGGTGTTG
GTGCTGGATTTTATTTGAATGCCACAAATGAGAAGTGGAAAAACTGGCGCATGTATGACTATGTTGTGAAGGAGCTGCCAAAAGTTTTAAGTGACAACTT
TGAACAGCTTAACACGTCATGTGCATCAATTTTTGGCCACTCTATGGGAGGTCACGGCGCACTGACTATCTACTTGAAGAACACTGACAAATACAAGTCG
GTGTCTGCATTTGCTCCAATTGCTAACCCAATAAACTGCCCTTGGGGTCAGAAAGCATTCTCAAACTATCTGGGCACAACTAAATCAGAATGGGAGGAAT
ATGATGCAACCCTGTTGGTTAAGAAGTGCAACACACTTTCAACTCCCATCTTGGTTGACCAGGGAGAGGACGACAAGTTCCTGGCGGAGCAGCTGCTGGC
GGGCAACTTCGAGGAGGCGTGCAAGGCGGCGGGCGCTCCCCTGACCCTGCGCATGCAGCCGGGGTACGACCATTCCTTCTTCTTCATCGCCACCTTCATC
GACGACCACATTGCGCACCACGCCCAGTTCCTCAAGAGCGGCTGACTGGCCGCTAGTCGCCTGTAGCGAGTGATGCGATCGGTAGAACTGCCGTGTCAGC
GGCCTCCGTATACCATCTGTGTTGTTATCACCTCTGTGTTAGTATGCGTGGATCGATGATGCACCGTGTGTTGGG
page-top