Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig3
Contig Information
Length 665 bp
Tissue Shoot grown under cold condition for 16days
Clones 2 Clones [Download: CSV  ,  FASTA ]
whv16n12b18    rwhv16n12b18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit synaptic glycoprotein SC2 [Zea mays] >gi|195622432|gb|ACG33046.1| synaptic glycoprotein SC2 [Zea mays] >gi|195626158|gb|ACG34909.1| synaptic glycoprotein SC2 [Zea mays] >gi|195639462|gb|ACG39199.1| synaptic glycoprotein SC2 [Zea mays] >gi|195644608|gb|ACG41772.1| synaptic glycoprotein SC2 [Zea mays] >gi|195658945|gb|ACG48940.1| synaptic glycoprotein SC2 [Zea mays]
Score 785
Evalue 6.44098e-82
Total Hit Count 419
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig3
CGTCTTCAGGAACTGCGCCTACTACTGGACCTTTGGAGCCTACATTGCCTACTACTGCAACCACCCTCTGTACACCCCTGTGAGTGACCTGCAGATGAAG
ATCGGGTTCGGCATCGGGGTCGTGTGCCAGATCGCAAACTTCTACTGCCACATCCTGCTGAGGAACCTCAGGAGCCCGACCGGCAGCGGCGGCTACCAGA
TCCCTCGGGGCTTCCTGTTCAACATCGTGACGTGCGCAAACTACACTACCGAGATCTACCAATGGCTGGGGTTCAACATCGCCACGCAGACCGTGGCGGG
CTACGTCTTCCTCGCCGTGGCGGCGGCTATCATGACCAACTGGGCGCTCGGGAAGCACAGCCGCCTGCGGAAGCTGTTCGACGGGAAGGATGGGCGGCCC
AAGTACCCCCGCCGATGGGTGATTCTTCCCCCATTCCTGTGAAGAAGACACAGTGCTCGCAGGGCCGGCATCTGGAGATTCAACATTTATTCTGTTCCAG
CGTCCGAAAGTTAAAAGCCATCAGTCGATTTCACGCATACATTCCTACTAATGGTGCCTTGTACCAGCCGTCAAACCTCAATTATGTAGTCCAAATGTTC
TTATCCGAAGGATGTATTTTCTTACCATATTGTTGAAAAACTTTCTCCGGGGTTTAAAAAAAAAA
page-top