Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig2
Contig Information
Length 450 bp
Tissue Shoot grown under cold condition for 16days
Clones 1 Clones [Download: CSV  ,  FASTA ]
whv16n18h03   
Homology (BLAST) Top Hit ice recrystallization inhibition protein 1 precursor [Triticum aestivum]
Score 103
Evalue 0.00341738
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig2
AGTGGACGCGTCACGGGGCTTCAGCTACCCGGGCGCGGCCTTGCGGGGCCCATCCCTAGAGCATCCTTGGCGGGCCTCGCGCAGCTGGAGGAGCTCAACC
TTGCCAACAACAAACTGATCGGCACCATCCCATCGTGGATTGCANACGAACACTCCAACAACAACAACCCAATATCATATCTGGGACCAACAACAAANTC
CGATCTGGTANAACCAATGTTGTATCCGGGAACNACAACACGGTTGTATCTGGGAATGACAACACTGTTGCTGGGANCAACAATACCATCACAACTGGGA
NCGGCAATACCGTAACTGGTANTAACCATGTTGTTTCTGGGACCAAACATATTGTAACTGACAACAACAATGTTGTTTCCNGNATANACAATAATGTATC
CNGNANCTTCCACACCNNATCCNNGNACTCTCAATACCNNATCCNGNANC
page-top