Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_V4816_all.Contig1
Contig Information
Length 622 bp
Tissue Shoot grown under cold condition for 16days
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhv16n15e23   
Homology (BLAST) Top Hit Unknown (protein for MGC:35458) [Homo sapiens]
Score 655
Evalue 6.49808e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_V4816_all.Contig1
CAATCGCATTGGATGCGATGCGGTACTTAGGTACAAAGGATAAAACATCAGATATTAAATTGGCATGCTTAAAAGGTGTAAAGGCAGCTCCCGTCGTCAC
TCCTCGCCGTTGGGTCGAAGTTCTTGGCAGTCTGGTCGGTGCATCCTGCCGGTACAGGCAAAGTACCTTGCTGTGCCCCTTTACCTCCTCCTATGCAGCA
AGAGATGGTGTACTGTGTGGTCCCGCCCATCCGACCCGCACCAGCGTCAAGATCGTTGATGAAGAGGCAGCACATCTTACCCTTCTTGATCATGTCTGCA
GCCTCACGGTACCGCTGCCTGATGAGCTTGGCTGGCTCTCCGGCGTTGCCACTCTCCAGCTCTCCGGCACTCATCATGATTGGGTTGATGCCCATCTTGG
CGAAGACAAGCTCGCACTGGAATGATTTTCCTTGACCCTTGCCTCCCCAGATACCCAAGATGAGTGGGATCTTGATGTTGGGCAGGGTCATGAAGTTCTT
GGAGAGATGGACAACAAGCTTGTCCATGAAAGCANGAGCGATGTANAAGCCTCCCATGGTGTTGTCNAANTCNTACTTCTTGANTCCCTGGNTGACNTAC
TCNNANGANCTGANGACNGCCT
page-top