Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2262
Contig Information
Length 818 bp
Tissue Shoot grown with dessication
Clones 61 Clones [Download: CSV  ,  FASTA ]
whsd10b03    whsd1b16    whsd1c08    whsd1i07    whsd3e13    whsd4e12    whsd4f14    whsd4m01    whsd4m15    whsd4m16    whsd5d11    whsd5o03    whsd6l03    whsd7e07    whsd7o10    whsd7o22    whsd9d16    whsd12b13    whsd14c22    whsd14f22    whsd15a03    whsd15c05    whsd16p05    whsd16p16    whsd17m23    whsd18k19    whsd18k20    whsd19j20    whsd19n03    whsd19n23    rwhsd10b03    rwhsd1c08    rwhsd1i07    rwhsd4e12    rwhsd4f14    rwhsd4m01    rwhsd4m15    rwhsd4m16    rwhsd5d11    rwhsd5o03    rwhsd9k03    rwhsd12b13    rwhsd14c22    rwhsd14f22    rwhsd15a03    rwhsd15c05    rwhsd15c06    rwhsd16p05    rwhsd16p16    rwhsd17g07    rwhsd17m23    rwhsd18k19    rwhsd18k20    rwhsd19j20    rwhsd19n03    rwhsd19n23    rwhsd3e13    rwhsd6l03    rwhsd7e07    rwhsd7o10    rwhsd7o22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 2.54099e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2262
TTTTTTTTTTACCATTAAAACGTATATAGTTGACATATTGTATAATATTATGCGTCCGTGCATATACATAGCCACCGATAGCATTCACATACGAGCATGC
TTTCTCGAGCCATGTTGGTACATGAACATGGACATACACATATTCTTAGGAACAAATAAGAAAGATAAATGGAGAAGGAAAACCCAAAGCAATGTCAGAG
TTGACAAAACTGCAATGGCACTTTATATATGGCCTGTCGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCCGGTGGCTTGAAGGCGATGAAG
CTGACGCACTGCACCTGACGCATGTTGTCGAATCCGATGATGCGGACATACGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTGATCACCTGTG
TGGCGTCAGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAATACCGGCCATCGTAGTACCCAGGAGATGCGTTGTGCTCACGGAAGATGAACCCAAC
CTTGCTGAACTCGAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTGAGGAGGGCCTCCGTGCTGAGCGGTGGCAGGTAAGACAGGGTC
TCGAACTTCTTGATGCCCTCGATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCCGAGGCTAGCGCCGTTGGAGCGGCGGCTGA
CGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTGGGGGCCATGGCTGTACTATGTAGGTATAT
AGCTTGCTAGGAGGAGGC
page-top