Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2257
Contig Information
Length 811 bp
Tissue Shoot grown with dessication
Clones 39 Clones [Download: CSV  ,  FASTA ]
whsd10a11    whsd10f21    whsd1b17    whsd2b05    whsd2m19    whsd2p03    whsd3a05    whsd4p04    whsd5b04    whsd5d08    whsd5f11    whsd7k23    whsd12g18    whsd12h05    whsd13a17    whsd18n11    whsd19m02    whsd20b22    whsd20e13    rwhsd10a11    rwhsd10f21    rwhsd1b17    rwhsd4p04    rwhsd5b04    rwhsd5d08    rwhsd5f11    rwhsd12g18    rwhsd12h05    rwhsd13a17    rwhsd13a21    rwhsd18n11    rwhsd19m02    rwhsd20b22    rwhsd20e13    rwhsd2b05    rwhsd2m19    rwhsd2p03    rwhsd3a05    rwhsd7k23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lipid transfer protein precursor [Triticum aestivum] >gi|54111986|gb|AAV28706.1| lipid transfer protein [Triticum aestivum] >gi|84617225|emb|CAH69208.1| type 1 non specific lipid transfer protein precursor [Triticum aestivum]
Score 466
Evalue 9.34696e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2257
TTTTTTTTTGTTAACCGAATAGAGGTAGATTAATTTATAATCCATATATGATAAGCGTACATCGTACAAAGTACAACAAACTCCCGTGTCTGCTCAAAGG
GAGTGAACGAACAATCAAACGCTGATACAAAATAGATACAACAGTGGCCAGCTATGCAAAGCTGGCTCGATGTACGTACTCCTATCTCTCACATGGAGAT
CATATCAGAGCATTTATTCATGTATATGTATATATGTGTGTGTGAGACCTCAACGTACTCAGCATCAATCGCTGGAACTATAATCGGCGATGATGGCGGC
CAGAAATCGATCAGTGGATCTTAGAGCAGTCCACGGATGCGCTGATCGTGTAGGGGACGCTGACGCCGCACTTGGAGGGAATGCCTGCGGCCTTGTTGGG
GTTGAGCCCTCCGGCAACACTCTTGAGGCACCTGCATGTAGCTTGCTTGTCGGCGGTGCTCCGCGCTAAGCCGGCCAATTTCCTGACGCCGCTGCAGCAG
GCCCCAGACGGGCTGGTCCCGCTGCCCTTCGCATAGGCGACGCAGGGGGTCAAGGCAGAGCTCACCTGGCCGCAGCTGATGGCCGCGTCGGAGGCTGCGA
GGATCATTGCCGCCACCAGGGCGACCAGCACGAGCTTAGTAGCTGCAGTGCGAGCCATCTCGACCGAGTTAGCTGTAGTTGTGGACCTTGTGGTGGTGGG
CTAGCTCACGGAGAGAGGCAACATGGCAATGTCTAATTCATAGTATAATGTGTCCACCACACATATAGACTACTAGCAGTAGCCGGCCATCCATTTTTAT
TTTATTCTTAC
page-top