Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2247
Contig Information
Length 973 bp
Tissue Shoot grown with dessication
Clones 30 Clones [Download: CSV  ,  FASTA ]
whsd10a14    whsd10h14    whsd1l08    whsd4f17    whsd4p23    whsd5n13    whsd8c22    whsd8j24    whsd9k02    whsd9l13    whsd9l14    whsd14a11    whsd14f14    whsd18h23    whsd20j02    rwhsd10a14    rwhsd10h14    rwhsd1l08    rwhsd4f17    rwhsd4p23    rwhsd5n13    rwhsd5o05    rwhsd8c22    rwhsd8j24    rwhsd9k02    rwhsd9l13    rwhsd14a11    rwhsd14f14    rwhsd18h23    rwhsd20j02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative brown planthopper-induced resistance protein 1 [Oryza sativa Japonica Group] >gi|48716345|dbj|BAD22956.1| putative brown planthopper-induced resistance protein 1 [Oryza sativa Japonica Group] >gi|125541636|gb|EAY88031.1| hypothetical protein OsI_09454 [Oryza sativa Indica Group] >gi|125584159|gb|EAZ25090.1| hypothetical protein OsJ_008573 [Oryza sativa (japonica cultivar-group)] >gi|164375547|gb|ABY52941.1| putative brown planthopper-induced resistance protein 1 [Oryza sativa Japonica Group] >gi|215678986|dbj|BAG96416.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215694386|dbj|BAG89379.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215701142|dbj|BAG92566.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737624|dbj|BAG96754.1| unnamed protein product [Oryza sativa Japonica Group]
Score 720
Evalue 4.50088e-74
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2247
CACAAGACAAGGAAGCAGTGAAGAGTAGCTAGCATCCATGGCGTGCATCAATACCTTGCAGAGCTGCTCCATGTTCAAAGGGGCCAAGAGTAAGGCCAGA
AGAGGTAGAGCCAGTGGCGGGACCTTTGAGTGCCGGGCGTCCACGTTCATGGACGGGAGCGGGCTCCGGCTCGGGCTCGACGAGAACCCCGATGCCATCA
TCTCCGGGGAGTGGCCCGAGAACTTCTCCCTCCTCAGCTACGACGACCTCCGCGCATACCTCCAGTCACAGCAGCAGCAGCAGCAACAACAACCATCCCA
TGCCGGCGATCAGCAGCGGGGGCCTCTCCTGCGTGAGGCCATGTCGACGCCCGTGCTGATGGTCACAGCGGAGCAGGCGCTGGTGGAGGTTGAAGGCCAC
TTCCAGCTCGTGTCAGGCCTCCCGGTTGTCGACAGTGCCCGCCGATGTGTCGGGGTCGTCGTCAAGAGCGATCACGTGAGGGCTTCACATGGGCCAAAGA
CGAAGATTGCAGATGTGATGACATCTCCAGCAATCACGCTATCATGCGATAAAACAGTGACCGATGCCGCAGCTCTGATGCTCAGGAAGAAGATCCACAG
ATTACCGATAGTAAACCAGGACAATCAAGTAATAGGTATAGTTACCCGCGATGACGTTCTTCGCGCGTTGGAGGCCATGCTGAAGTTTTAGAGATGCAGG
AGTCCATGCCCGGTACTTGTGGATCTGTAAATATGTGTGTCCGCGGTACTTTGAGTAGCAGGCAGATCCTATAGTCTGTAAAAGTGTTTGCAGTCTGTAT
CGCAAAAAATAAGCCTGGGAGCATTTAGGAGAGCTTTTCCTTGTAAAGAAGCACGCCAGGAAGCTTCTGCTCTGTACTGTACTGTTTGGTATCTGCACAC
GAAAATGTTTCCATGAGCAATGACTTCCAGATTCCACGGCAAGAAAAACAAAAACTCATTGTAATATTAAGAG
page-top