Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig4
Contig Information
Length 221 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 1 Clones [Download: CSV  ,  FASTA ]
whfl43n06   
Homology (BLAST) Top Hit seed maturation protein [Zea mays]
Score 108
Evalue 0.000915189
Total Hit Count 6
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig4
gggatctttgtgtgaccgcgcagccaagggggaaagaaagaagaaaaggaaaaccaaccagaagaaaagctcgggggtttcttagcgtgggaggagagga
ggagagcgtgggcgagggagcatggcggagcacaaggaggagccggtggcggagtccatgatggacaagatctccgacaagttccacggcggggactcct
cgtcgtcctcctcggactcgg
page-top