Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2240
Contig Information
Length 2494 bp
Tissue Shoot grown with dessication
Clones 22 Clones [Download: CSV  ,  FASTA ]
whsd10d23    whsd10e10    whsd3o19    whsd11b22    whsd15p18    whsd17o21    whsd19l09    whsd19l15    whsd20d17    whsd20l15    whsd20o13    rwhsd10d23    rwhsd4p07    rwhsd11b22    rwhsd12j14    rwhsd17g02    rwhsd17o21    rwhsd19l09    rwhsd19l15    rwhsd20d17    rwhsd20o13    rwhsd3o19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamine-dependent asparagine synthetase [Triticum aestivum]
Score 3036
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2240
CGAGACGAGACCAGAGCACCCAGAACGGCAAGGGAAAACAATCAATAGTAGTCCTGTGTGTTTGACACGCCTCTTGCCACCCACCACCCAAAGACGAGAG
AAGAGAGACCAGACACCCTGATGCATGACGACGACGACGATGATGCGACCTACCTAAGCGGACTACGCGTAGTATGCAACCAAACGGAAAATCAAATATG
TTGGAAGAATTTCGTCCAAATCCTCCAGTGGCCACCCACCAAATCCAACCCAACCCATCACTGATCATCGCACGGCGATCGGCGCCGATCGGCTTCAGGG
CTTCCACAGGATGGTGGTCTCGGCGATCATCGAGGTGACCACGTATGGGTCCATGTTGGACGCCGGCCGGCGGTCCTCGAAGTAGCCCTTGCCGTTCTGC
TCCGTCTCCCGGCCCACGCGCACCGACGCGCCACGGTTCGCGACACCCCAGCTGAAGGTGTTGATGTCGGCGGTCTCGTGCTTGCCGGTCAGACGGCGCT
CGTTGCCCTCGCCGTAGGCGGCGATGTGCTCCTTGTGCTTCAGCTTGAGCTTCTCGACCCTCGTGCCGAATTCGGCACGAGGGAGAGATCTTCTAGCTAC
ACACTGTTGCCGTCGATCCAGCAAAAATGTGCGGCATACTGGCGGTGCTGGGCTGCGCCGATGACACCCAGGGGAAGAGAGTGCGCGTGCTCGAGCTCTC
GCGCAGGCTCAAGCACCGCGGCCCCGACTGGAGCGGCATGCACCAGGTTGGCGACTGCTACCTCTCCCACCAGCGCCTCGCCATTATCGACCCTGCCTCT
GGCGACCAGCCGCTCTACAACGAGGACAAGTCCATCGTCGTCACAGTGAATGGAGAGATCTACAACCATGAACAGCTCCGGGCGCAGCTCTCCTCCCACA
CGTTCAGGACAGGCAGCGACTGCGAGGTCATCGCACACCTGTACGAGGAGCATGGGGAGAACTTCATCGACATGCTGGATGGTGTCTTCTCCTTCGTCTT
GCTCGATACACGCGACAACAGCTTCATTGCTGCACGTGATGCCATTGGCGTCACACCCCTCTATATTGGCTGGGGAATTGATGGGTCGGTATGGATATCA
TCAGAGGTGAAGGGCCTGAATGATGATTGTGAGCACTTTGAGATCTTTCCTCCTGGCCATCTCTACTCCAGCAAGCAGGGAGGCTTCAAGAGATGGTACA
ACCCACCTTGGTTCTCCGAGGTCATTCCTTCAGTGCCATATGACCCACTTGCTCTCAGGAAGGCTTTTGAAAAGGCTGTCATCAAGAGGCTTATGACGGA
CGTTCCATTCGGTGTTCTACTCTCTGGTGGCCTAGACTCATCATTGGTTGCAGCCGTTACAGTTCGTCACCTGGCAGGGACAAAGGCTGCAAAGCGCTGG
GGGACTAAGCTTCATTCTTTTTGTGTCGGACTTGAGGGGTCACCTGATCTGAAGGCCGCAAAGGAGGTAGCCAATTACCTGGGGACCATGCACCATGAGT
TCACCTTCACTGTTCAGGACGGCATTGATGCAATTGAGGATGTGATTTATCACACCGAAACATATGATGTGACGACAATCAGGGCAAGCACGCCAATGTT
CCTGATGTCACGCAAGATCAAGTCACTTGGCGTCAAGATGGTCATCTCTGGTGAGGGTTCCGATGAGATTTTCGGAGGGTACCTCTACTTCCACAAGGCA
CCCAACAAAGAGGAGCTCCACCGTGAGACATGTCAAAAGATCAAAGCTCTGCATCAGTACGATTGCTTGAGGGCCAACAAGGCAACATCTGCATGGGGCC
TCGAAGCACGTGTGCCATTCTTGGACAAGGAGTTTATCAATGAGGCAATGAGCATTGATCCTGAGTGGAAGATGATCCGGCCTGATCTTGGAAGAATTGA
GAAATGGATGCTGAGGAAAGCATTTGATGACGAGGAGCAACCATTCCTGCCGAAGCACATTCTGTACAGGCAGAAAGAGCAGTTCAGTGATGGTGTTGGC
TACAGCTGGATTGATGGCCTAAAGGCTCACGCAGAATCAAATGTGACAGATAAGATGATGTCAAATGCAAAGTTCATCTACCCACACAACACCCCGACTA
CAAAAGAGGCCTACTGTTACAGGATGATATTTGAGAGGTTCTTCCCCCAGAACTCGGCGATCCTGACGGTGCCAGGTGGGCCAAGCGTTGCATGCAGCAC
GGCGAAGGCGGTAGAGTGGGATGCCCAGTGGTCAGGGAACCTGGATCCCTCAGGGAGAGCAGCACTTGGAGTCCATCTCTCGGCCTATGAACAGGAGCAT
CTCCCAGCAACCATCATGGCAGGAACCAGCAAGAAGCCAAGGATGATCGAGGTTGCGGCGCCTGGTGTCGCAATTGAGAGTTGATGGTGTCCTGTCCTGC
TTGCCGTTTCTGATAAGAAATAAGATGTACCTGGTCTTGCCATTAGAGTGGTGCAGACCTAAGGTTTGAGTGAAGATTGTGCATTAATGTTCTA
page-top