Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2233
Contig Information
Length 744 bp
Tissue Shoot grown with dessication
Clones 18 Clones [Download: CSV  ,  FASTA ]
whsd10d10    whsd10d21    whsd3g24    whsd8e06    whsd9e06    whsd11g02    whsd11n10    whsd13k12    whsd14c21    rwhsd10d10    rwhsd10d21    rwhsd8e06    rwhsd9e06    rwhsd11g02    rwhsd11n10    rwhsd13k12    rwhsd14c21    rwhsd3g24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_33098 [Oryza sativa Indica Group]
Score 256
Evalue 1.79222e-20
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2233
TAACCTCACTACTCTTAAGCCACAAAAGATTTTTGCTACCAGCACCTAAGCTCCAATGGAGGGTGAGAAGAACTCGTCCGGGGACCTGATGTCCAGCAGC
AAGCTGGTCGCGGAGGCCGCCAAGACGGCCTACGAGAAGAAGAGCGTCGAGGGCATCGACAAGGAAAAGGTAGCCGCCGCCTCCGCCGACATCCTCGACT
CCGCCGCCAAGTACGGCAAGCTGGAGGACAAGCCGGTGGGGCAGTACCTCGAGAAGGCTGAGGGGTACCTGAAACAGTACAGCTCCGGCGGCACCGAGAA
GGAGAAAACCGACGCACCTGCTGCCGCTGACGCACCGAAGCCGGATGCACCCAAGGAGGCAGCGCCTGCGCCTGCCCCTGCCGCGGAGGAAGAGAAATCG
TCCGATGGGTTCGGTCTCGACGACGTCATGAAGGGGGCTGCATCGCTGTCGGGGAAGAAGAGTGGCGAGGAGGAGAAGGAGAGCGGCGGCGGCGGCGGGT
TCATGAAGATGGCTCAGGGGTTCATGAAGTAGAAGTCTGGTTTCTACATCTACATGCATGTAGCTCTTGTTAAGTTTGTGCGCTGCGTTACTTCTGTATT
TTGTTACTCTATAACGTTGTGGTTGTGCTTAATTATGTTAGCTGCTGATATCTGGTTCTGTAAAGTTTCTTAAGTCATGTCTGTCTGTATTGATGATCAA
TAATCCANTTGTGCTANCTACCCTTTTTTTTGTTAAAAAAAAAA
page-top