Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2226
Contig Information
Length 1220 bp
Tissue Shoot grown with dessication
Clones 16 Clones [Download: CSV  ,  FASTA ]
whsd10h20    whsd1a20    whsd3e17    whsd4k16    whsd8a20    whsd8e24    whsd13l16    whsd14k19    whsd18m21    whsd18n09    rwhsd10h20    rwhsd8e24    rwhsd13l16    rwhsd18m21    rwhsd18n09    rwhsd3e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit aquaporin PIP1 [Triticum aestivum]
Score 1460
Evalue 9.87445e-160
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2226
ATCTCCTCCACCTCTCAACCAAGCCAAGGCCAAGAGCCCAGTGAAGCAGCGGCCATGGAGGGCAAGGAGGAGGACGTGCGGCTGGGCGCGAACCGCTACT
CGGAGCACCAGCCCATCGGCACGGCGGCGCAGGGCGGCGGCGCGGACGAGAAGGACTACAAGGAGCCGCCCCCGGCCCCCTTCTTCGAGGCCGGGGAGCT
CACCTCCTGGTCCTTCTACCGGGCGGGGATCGCCGAGTTCCTGGCCACCTTCCTCTTCCTCTACATCTCGGTGCTCACCGTGATGGGCGTGGTGGGCAAC
CCGTCCGGGTCCAAGTGCGGCACGGTCGGCATCCAGGGCATCGCCTGGAGCTTCGGCGGCATGATCTTCGTGCTCGTCTACTGCACCGCCGGCATCTCCG
GCGGCCACATCAACCCCGCGGTCACCTTCGGGCTGTTCCTGGCCAGGAAGCTGTCGCTCACCAGGGCCGTGTTCTACATCGTGATGCAGTGCCTGGGCGC
CATATGCGGCGCCGGCGTGGTGAAGGGGTTCCAGACCACGCTGTACCAGGGCAACGGCGGCGGCGCCAACTCCGTCGCGCCCGGGTACACCAAGGGGGAC
GGGCTCGGCGCCGAGATCGTCGGCACGTTCGTGCTGGTGTACACCGTCTTCTCCGCCACCGACGCCAAGCGCAGCGCCAGAGACTCTCACGTCCCCATCC
TGGCGCCGCTTCCGATCGGGTTCGCGGTGTTCCTGGTGCACCTGGCGACGATCCCCATCACGGGGACCGGCATCAACCCGGCGAGGTCCCTCGGCGCCGC
CATCATCTACAACAAGAAGCAGGCGTGGGACGACCACTGGATCTTCTGGGTGGGCCCGTTCATCGGCGCGGCGCTGGCGGCCATCTACCACGTGGTGGTG
ATCCGGGCCATCCCCTTCAAGAGCCGCGACTAGTCCACCAATCAACCAGCCGCGAATGGAATCTTATCGCTGTTCATCGTCGGTCGATCGATCATGTGGT
GGTGGTGGTGGTTGCTCGCGCGCGCGTAGTACGTGGATCATGTCTCGGCCGCGCACGCTGTAATCATCTATATCTACCGTGCTGTTCCTCCCCTCCTCGG
TGTGTGTGCCTGTCGGCAGCGTCACCTGTTCAAGTCTGCGAGTTTCAGTACTCCCTGTTGTACTTTCCCTTCCTTTTGTATTGCACGCGGTTTAATGGAG
CGTGCATATGTATGAAATAC
page-top