Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2219
Contig Information
Length 763 bp
Tissue Shoot grown with dessication
Clones 15 Clones [Download: CSV  ,  FASTA ]
whsd10d05    whsd2p08    whsd6k05    whsd13n02    whsd14l03    whsd15l02    whsd16h05    rwhsd10d05    rwhsd14l03    rwhsd15l02    rwhsd15l13    rwhsd16h05    rwhsd20j14    rwhsd2p08    rwhsd6k05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Dictyostelium discoideum AX4] >gi|60469697|gb|EAL67685.1| hypothetical protein DDBDRAFT_0205801 [Dictyostelium discoideum AX4]
Score 122
Evalue 6.47799e-05
Total Hit Count 463
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2219
TCTGTTTAATCATGGTACATCACACGGGAGACACACTGACGCAAAGATGGCTCACACGAACAAACTGGAGACAACACGTACAGAGACGGAGGGAACACAT
GCAATACATTACTAACCATTACCGGAGACAACTTAAGCACCAACACCCATGCAAATGCAGGCAGGCTAATTCTCCATTACCAAGCGGCTGCTGACGAGCC
TCCCTCCCGTCAGTTGAAGTAGCCTGACGGCGAACGTGGCGGCTGCTTCGGCTGCGAGGACGATTGTTCCGGCGTCTGGGGTTTGGGGTCCGGCTTCGGG
CTGGGGCCCGGGGCAGGCTTTGGGTCGGGCGTGGGCTTGGGGTCAGGCTTTGGCGCCGGTCTAGGGTCGGGCTGCGGGTCTGGTTTGGGGTCGGGTTTGG
GTGCTGGGTCAGGTTTCGGCGCCGGTTTGGGGTCGGGCTTGGGTGCTGGGTCAGGTTTCGGCACCGGTTTTGGGTCTGGTTTTGGGTCAGGTTTTGGCGC
GAGTTTAGGGTCGGGCTTGGGTGTCGGGTCAGGTTTCGGCGCGAGTTTAGGGTCGGTCTGCGGGTCTGGTTTGGGGTCAGGCTGTGGCGTAGGCTTCGGC
TCTAGGCTGGGCTCATGTTTCAGCTCCGGCGCCCTCCCAGCGACGGCGAGGCTAGCAACATTTGCCGCGACGAGGGCCAACAGCAAGCACAGCGAGAAGG
CGGATGCCCTCATCGTCGCCGATCACTAGCTAGCTGCTCACAGCTCACTCAGCTCACTTGCTT
page-top