Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2214
Contig Information
Length 1545 bp
Tissue Shoot grown with dessication
Clones 14 Clones [Download: CSV  ,  FASTA ]
whsd10e11    whsd4a06    whsd7g18    whsd7h05    whsd7h06    whsd12p24    whsd16m22    rwhsd10e11    rwhsd4a06    rwhsd12p24    rwhsd16m22    rwhsd7g18    rwhsd7h05    rwhsd7h06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|48475219|gb|AAT44288.1| putative B2 protein [Oryza sativa (japonica cultivar-group)] >gi|51038049|gb|AAT93853.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579502|dbj|BAF17865.1| Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|218197041|gb|EEC79468.1| hypothetical protein OsI_20486 [Oryza sativa Indica Group]
Score 1361
Evalue 4.09416e-148
Total Hit Count 104
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2214
TGTGTGGGCGGAGCGAAGTGGGAGCCAACGCCAAGCCAGCCGAGCCGACTCCTATCCTCCTCTTCCCCTTCCCCGCAGCAGTTTCCCCAAATCCAGCGCC
CTCCCCGCCGGAATCCGGCGCCGAATCGAGCAGAGAGCTTGAACTGAGCTATGGACAACTTGTGGCATCTCGGAGATGAGTTCCGTGGGCAATCAAAGGT
GGTGGAGGACCGCCAATGGTCTCTCATGACATCAAAGCTTGCTGAGATCACAAAGTCAAAGGCTGAGAGGATGAATGACTTTGAGTATGCACGGATGAAC
ACCGTCCCTGATGTCAAGCAATGGGATAAGCTATCCTACCACCAAGAAGACAACAAGATGGACCACCTCAATCTTGGCTTGATGAACCTGGATCTTAAGA
TGAATGATCTCAAGATGAACGAGGCTGCCATGAAGTACCCTTTCCGCAACATGGCCTATAACATGAATCCGATGTACCCCAAGGGAAACAACGGTAATGT
CAATTCGTTCAAGATGAATGTTGGGGTCAACAAATATCCCAATAATCAGAATGGGAAGGAAACAAACGGCAAACACAATGGTGGTAACAACAACAATGGA
GGCAACAGCAACAACAACTCTGTTGACAAGCGCTTCAAAACATTGCCAACAAGCGAGATGCTACCGAGGAATGAAGTTCTTGGTGGATACATCTTTGTCT
GCAACAATGATACCATGCAGGAGGATCTCAAGAGACAGCTTTTTGGCTTGCCAGCAAGATATCGTGATTCAGTCCGAGCCATCACTCCTGGTCTACCTCT
TTTCCTCTACAACTACACGACCCATCAGCTACATGGGGTGTTTGAGGCTGCCAGTTTTGGAGGATCAAACATTGATCCCACTGCTTGGGAAGATAAGAAG
TGCAAAGGTGAATCCAGATTCCCAGCACAGGTGAGGATCCGCATTAGAAGGCTTTGCAAGGCCTTGGAAGAGGATGCTTTCAGGCCAGTGCTGCACCACT
ATGATGGTCCTAAATTCCGCCTGGAGCTCTCCATAGCAGAGACACTGTCACTGCTAGACCTGTGCAAGACAGAAGACGCCTGATCGGCTTCGGAACATGG
TTGTGGTTGCTCTGTGGTTCTTTTTAGTAAATATCATCCCTGTAAGTTGTGGAAGATGTTTTCACAATGATCTGTTCCGTCCTTCGTCCATGAAAGCGCA
AGCTGTTGGTTGGTGGTTGCATTTCCCCCAGAAAGGACCTGGTACTCGGAAGAAGTAGGCCTCTAAAGATGTGAGCCTGTCTGTGTCGGTGCCGTCTGTC
CGTAATCTTGGTGATGTGTATGTTCTTCTTCATATTTATGTATTTGTAGTGCAGTATGCCCGCCGTCAGCGGGGAAACCCCGAAAGACGGGGGATACTGT
TGTGATGCATCATGAATGCCCCAAAGTGAGGGCGGGTGATGTTGGGAGTGTACCCTTGTTGTCTTTGTACCTTACCCTTGGTTTGGAAAGCTGGAACCTT
GCATTTGACTTGATGCTGCTGTTTTCTGTGCCGCCTGTGTGAAAC
page-top