Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2200
Contig Information
Length 848 bp
Tissue Shoot grown with dessication
Clones 12 Clones [Download: CSV  ,  FASTA ]
whsd10a07    whsd10a08    whsd4f22    whsd4m09    whsd20d21    rwhsd10a07    rwhsd10a08    rwhsd4f22    rwhsd4i20    rwhsd4m09    rwhsd5g06    rwhsd20d21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit allene oxide synthase [Hordeum vulgare subsp. vulgare]
Score 799
Evalue 2.47502e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2200
TTTTTTTTTTACCGTACGCCAAGAGTGAGAATCTTATTACAGGAAAGTCCGGCTTATTACACTGGGCAAGATTGCGAAAAGTAAAACACACATACACAAG
GGCACCATGCAGGATGCAGCGATGCAGCGAAGCAACCGAACAAGATGCATGCATGACTGACTCGTACTAGTAGTATATAGCGAGGCACGTACGTACGTGC
GCGCTGACGGGGACGATTGATGGCTGCTGTGAGAGAGCTGCTGCGGTACGTTGATCCGATGACCGGTGCAGGTTCTAATTTTTAAACAGCGCTCTCAGGA
CCGGACGTGGCCTTGGTGACGCCGGTGAACTCAACCTTGGTGCCGAGCAGGTCGACCCCGACGTCGGCGGTGAAGGTGTCGTACCGGAGGAACAGCTCCA
CCACCAGGAGCCTGCCCACGAGCACGACCAGGTTCTTGCCTGGGCACTGCTTGTTGTCCACGCTGGGGCTCTCGGTCTCCCGCCCGTTGGACCAGTACAC
GTACTGCAGCAGCTTCCTTCCCTCCTCCCCGACGAACCGGTCGCCGACGAACTCCCTCGCCGTGGAGCCGAACACGCGGGGGTCCCTGGTGGCGCACGGC
TGGTACCCGAACAGCATCTCCCCCTTCTTCACGGCGAACACCGCGTCGTGGCTCTCGATGTTCATGTCCGCCTTGGCGCGGCCGTACTGGAACTTGACGG
GCGGGTCCAGCCGCAGCGCCTCCCACACCGCCGACTTGGTCAGCTCCATCTTATCCAGCGCCTCTATCGTCACCTTGCCGCCGGCGTCCGCCACGGCGGC
GCGTATCTCCGCGACGAGCTTCTGGTGGAACTTCTCTCCGGCCCCCGC
page-top