Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2188
Contig Information
Length 1322 bp
Tissue Shoot grown with dessication
Clones 11 Clones [Download: CSV  ,  FASTA ]
whsd1l13    whsd3g05    whsd3g17    whsd6g11    whsd11o23    whsd18a13    rwhsd1l13    rwhsd11o23    rwhsd18a13    rwhsd3g05    rwhsd6g11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glyceraldehyde-3-phosphate dehydrogenase, cytosolic >gi|18978|emb|CAA42901.1| glyceraldehyde 3-phosphate dehydrogenase [Hordeum vulgare]
Score 1644
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2188
CCCGTCCCCAGCCAACCTCCCATCTCCGTCTCGCGTCGCGGCGGCAGTTCCACTCCCTCGCCATGGGCAAGATTAAGATCGGAATCAACGGTTTCGGAAG
GATCGGGAGGCTCGTCGCCAGGGTAGCCCTCCAGAGCGACGATGTCGAGCTCGTCGCCGTCAACGACCCCTTCATCACCACCGAGTACATGACCTACATG
TTCAAGTACGACACCGTTCACGGCCACTGGAAGCACAGTGACATCAAGCTCAAGGACGACAAGACTCTGCTCTTTGGCGAGAAGCCAGTTACCGTCTTCG
GCGTCAGGAACCCTGAGGAGATCCCGTGGGGTGAGGCTGGTGCCGATTACGTTGTGGAGTCCACCGGTGTCTTCACTGACAAGGACAAGGCCGCTGCTCA
CTTGAAGGGTGGTGCCAAGAAGGTGGTCATCTCTGCCCCAAGCAAAGATGCCCCTATGTTTGTGGTTGGTGTCAACGAGGACAAGTACACCTCAGACGTT
AACATTGTCTCAAATGCTAGCTGCACCACTAACTGCCTTGCTCCCCTAGCTAAGATCATTAATGACAACTTCGGTATTATTGAGGGTTTGATGACCACTG
TTCATGCCATCACTGCCACACAGAAGACCGTTGATGGTCCCTCGAGCAAGGACTGGAGAGGTGGCAGGGCCGCAAGCTTTAACATCATTCCCAGCAGCAC
TGGTGCTGCTAAGGCTGTTGGTAAGGTTCTTCCTGAGCTGAATGGCAAGCTTACCGGTATGTCTTTCCGGGTTCCCACTGTGGATGTGTCAGTTGTTGAT
CTCACTGTTAGAACCGAGAAGGCTGCATCATATGATGACATCAAGAAGGCTATCAAGGCTGCATCTGAGGGGAAGCTCAAGGGGATCATGGGTTACGTTG
AGGAGGATTTGGTCTCCACCGACTTTGTTGGTGACAGCAGGTCGAGCATCTTTGATGCCAAGGCTGGAATTGCTCTGAACGACCATTTCGTCAAGCTTGT
CTCGTGGTATGACAACGAATGGGGTTACAGCAACCGCGTTGTCGACCTGATCCGCCACATGGCCAAGACTCAGTAGAGTGCTCTGCTTTCCTTTGTGGCG
CCTGGTCAGAGGTGTCCCTGCTTTGTCTATGCGAAGAATAAATGTGGATGGCGTCGCCAGACGACGCCTGGTTCATGTTAGTTGGACATGAGTTACCTTC
TGTTTTCCGCATCAACTAGTATCTGTAATGGAGTTGCTAATCAAGTACTCTTTTTTGGTTGTGGTTTGTGAAGAATATATAAATCGTTCAGTCCAGTACT
TGTGTTTGCCTTAAAAAAAAAA
page-top