Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2169
Contig Information
Length 1546 bp
Tissue Shoot grown with dessication
Clones 10 Clones [Download: CSV  ,  FASTA ]
whsd17m02    whsd17m13    whsd17m14    rwhsd10e10    rwhsd11b16    rwhsd15p18    rwhsd17m02    rwhsd17m13    rwhsd17m14    rwhsd6o06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutamine-dependent asparagine synthetase [Triticum aestivum]
Score 1358
Evalue 2.75487e-158
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2169
CGTACAGGTAACCACCCTTTCGATTTTGATCGTGGTGCATGCTGCAAACGAATAAGATCGTTCAAACTCCCAAGCCATTGAGCTTCCCTAACTAGTCACA
CCAGAAAGGATGTATGTATACAAGTCTTGGTATACAAAAAATCCATCAAGAACTGATCAAGGCGTCCCTCCTACAGTGCCTCGAACGACTGTTATGTGAC
GAGTGTTCGTTCTATGGCCTTCCTCTCCGGAAAGAAACTGCGTCTCAGGGCTTCAGCCTCGCGATCCATCAAGCTTAAAACCACCTTTCAGGCACCTTGT
CTCGATTCCCACCACAGTTCCTCCCGGGGTAAGCATGGAGGACTTCGTCGAACCTTCCGGATCGAGCCCAATGGCCCATTTTCATAAATGGCAAATACAC
AATCCATCCAAATCGGGGCCTGAGCCTTAGCTAGCCATCATCAACGCTCATCTTTTCAGCGCCTTTCCCAGCCGCGCTCCGCTGCATCTGCACCTGCAGG
GCGTGTTTCTTTTCCTCGTGCCGAATTCGGCACGAGGTTTTTTTTTTTGGAAATCATCCGGTCTCCGATTTCATAAGAACAATAGATACATTAATGCACA
ATCTTCACTCAAACCTTAGGTCTGCACCACTCTAATGGCAAGACCAGGTACATCTTATTTCTTATCAGAAACGGCAAGCAGGACAGGACACCATCAACTC
TCAATTGCGACACCAGGCGCTGCAACCTCGATCATCCTCGGCTTCTTGCTGGTTCCTGTCAAGATGGTTGCTGGGAGATGCTCCTGTTCATAGGCCGAGA
GATGGACTCCAAGTGCTGCTCTCCCTGAGGGATCCAGGTTCCCCGACCACTGAGCATCCCACTCTACCGCCTTTGCCGTGCTGCATGCAACGCTTGGCCC
GCCTGGCACCGTCAGGATCGCCGAGTTCTGGGGGAAGAACCTCTCAAATATCATCCTGTAACAGTAGGCCTCTTTTGTAGTCGGGGTGTTGTGCGGGTAG
ATGAACTTTGCATTTGACATCATCTTATCGGTCACATTTGATTCTGCGTGAGCCTTTAGGCCATCAATCCAGCTATAGCCAACACCATCACTGAACTGCT
CTTTCTGCCTGTACAGAATGTGCTTTGGCAGGAATGGTTGCTCCTCGTCATCAAATGCTTTCCTCAGCACCCACTTCTCAATTCTTCCAAGATCAGGTCG
GATCATCTTCCACTCAGGATCTATGCTCATTGCCTCATTGATAAACTCCTTGTCCAGGAATGGCACACGTGCTTCGAGTCCCCATGCAGATGTTGCCTTG
TTGGCCCTCAAGCAATCGTACTGATGCAGAGCTTTGATCTTTTGACATGTCTCACGGTGGAGCTCCTCTTTGTTGGGTGCCTTGTGGAAGTAGAGGTACC
CTCCGAAAATCTCATCGGAACCCTCACCAGAGATGACCATCTTGACGCCAAGTGACTTGATCTTGTCGTGACATCAGGAACATTGGCGTGCTTGCCCTGA
TTGTCGTCACATCATATGTTTCGGTGTGATAAATCACATCCTCAAT
page-top