Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2164
Contig Information
Length 1612 bp
Tissue Shoot grown with dessication
Clones 10 Clones [Download: CSV  ,  FASTA ]
whsd10c07    whsd5j20    whsd5o12    whsd11k08    whsd14h02    whsd17g17    rwhsd10c07    rwhsd5o12    rwhsd14h02    rwhsd17g17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|396134|emb|CAA80666.1| protein synthesis elongation factor-1 alpha [Hordeum vulgare subsp. vulgare]
Score 2233
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2164
GCCGCCGCAGGCTTTGACCCCATCGCCCCTCCGTCCTCTTCGTCTCCGGTAGGCCAGGTAGTTAACAGCTCCAGCAGCCATGGGAAAGGAGAAGATCCAC
ATCAGCATTGTGGTCATTGGCCATGTCGACTCTGGCAAGTCAACCACGACTGGCCACCTCATCTACAAGCTTGGAGGCATTGACAAGCGTGTGATTGAGA
GGTTTGAGAAGGAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTATGCCTGGGTGCTTGACAAGCTCAAGGCTGAGCGTGAGAGGGGTATCACCATTGA
TATTGCTCTGTGGAAATTCGAGACCACCAAGTACTCCTGCACTGTCATTGATGCTCCTGGTCACCGTGATTTCATCAAGAACATGATCACCGGGACCTCC
CAGGCTGATTGTGCTGTGCTTATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCTCCTTGCTT
TCACTCTTGGTGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACTCCCAAGTACTCGAAGGCCCGTTATGAAGAAATTGTCAAGGAAGT
CTCTTCATACCTGAAGAAGGTTGGTTACAACCCTGACAAGGTTCCCTTTGTTCCCATCTCTGGGTTCGAGGGCGACAACATGATTGAGAGGTCTACCAAC
CTTGACTGGTATAAGGGCCCCACCCTTCTTGAGGCCCTGGACCAGATCAATGAGCCCAAGAGGCCCTCCGACAAGCCCCTGCGTCTTCCCCTTCAGGACG
TGTACAAGATTGGTGGCATTGGAACTGTGCCAGTGGGGCGTGTTGAGACTGGAGTCATCAAGCCAGGCATGGTTGTCACCTTTGGTCCTACTGGCCTGAC
CACTGAGGTGAAGTCCGTTGAGATGCACCATGAGTCTCTCCTGGAGGCGCTTCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTGGCTGTCAAGGAT
CTCAAGCGTGGGTACGTCGCTTCCAACTCCAAGGACGACCCTGCCAAGGAGGCTGCCAACTTCACCGCCCAGGTCATCATCATGAACCACCCCGGCCAGA
TCAGCAACGGCTATGCCCCGGTGCTGGACTGCCATACGTCCCACATTGCTGTCAAGTTTGCTGAGATCCAGACCAAGATCGACCGGCGGTCTGGCAAGGA
GATTGAGGCGGCGCCCAAGTTCCTCAAGAACGGTGATGCTGGGTTCGTCAAGATGATCCCCACCAAGCCCATGGTGGTGGAGACCTTTGCCCAGTACCCT
CCCCTGGGCCGCTTTGCTGTGCGTGACATGAGGCAGACGGTTGCCGTGGGTGTTATCAAGGCTGTGGAGAAGAAGGATCCGACCGGTGCCAAGGTGACCA
AGGCTGCGGCCAAGAAGAAATGAGATGGTGTCAGGTTCTTTACTGCATCTATGGTGGCGGTGGCGGTATTTGGTGGTGGTGATAGTTGTTCTAGTTGTTT
TGGAAACTTGTTAAGCTTCGGTTATTTGTGTCGAGCAGTGTTGGAACTGCTTATTGCTCTGTCATTGTATCGTTCGGTTGTGTTGGTGAAACTTCGTCAG
TTAATGTTGCTA
page-top