Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2125
Contig Information
Length 883 bp
Tissue Shoot grown with dessication
Clones 8 Clones [Download: CSV  ,  FASTA ]
whsd10g14    whsd9j03    rwhsd10g14    rwhsd8l16    rwhsd9j03    rwhsd19a06    rwhsd3m02    rwhsd6c04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine synthetase 2 [Triticum monococcum]
Score 862
Evalue 1.30974e-90
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2125
TTTTTTTTTTGGAATTACACATGGCTCTTTATTATTCTTTCCGAGACTCAGGAAGAAAGAGCAGTATGAGGAACTACACAACAAAGAATATGAAAAGTGA
AAGTGACAGAGCGACTAACAGAGCAAACTGCACATCACTCAGCAGTTTCAGCGACTCAAAATGGAAAGGATAAATATATGAAATGACATTAAGAAACTTA
GCACTGACTACCATACAACAAGACCAGTGTAGAGCGTCGCTTCAATGTCTAATGCTTCTTCCCACTTCCCAGGAGCAACATGATCCCGTCTTGACGAACT
TGAGAGGCGGCAGACCAAGAGAATGCCATGCTCTTAGGCAGATGCCTTGTCGAACTTGAGGGGCTTCACCACCTCCCAGGTGAAGTCGGCATCATCACGG
CCAAAGTGACCGTAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTTCTTCAAGTCCAGGTTGATGCTGATCATCCCGGGCCTGAAGTCAAAGTTCTCCT
TCACGAGCTTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAGGAGTCGACGAACACAGACAAAGGCTCAGGCACACCGATGGCGTATGAGATCTG
CACAATGCAGCGGCGTGCGAGGCCGCTGGCGATGATGCTCTTGGCGGCCTGCCTGGCAATGTAGGCGCCACTGCGGTCGACCTTGGTTGGGTCCTTGCCA
GAGAAGGCACCGCCGCCGTGGGCTCCCCAGCCACCATAGGTGTCGATGATGATCTTGCGGCCGGTGAGACCGGCGTCACCATGGGGGCCGCCGATGACGA
AGCGGCCAGACGGGTTCAGGTGGAANATGGTGTTCTCATCNAGGTACTTTGCGGGGATCACCGGCTTGATGACATGCTCCTTG
page-top