Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2114
Contig Information
Length 1257 bp
Tissue Shoot grown with dessication
Clones 8 Clones [Download: CSV  ,  FASTA ]
whsd1j18    whsd9k21    whsd9n12    whsd13d13    rwhsd1j18    rwhsd9k21    rwhsd9n12    rwhsd13d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1636
Evalue 3.9944e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2114
AATTGTTTCCTCTTCCAGCAAATGTACTGTCCTGTAAATCATCAGGCAAAAGGGGAGCTACAAGCCTCATTCATACACACTGGGAAAACCAGCGAAAAGG
AGCATGCATCGCGATGTGCGGCTGTTCTGGGTGGAGACGAGAGTTTCTAAGGAGCGGAAGGTTTCATTTATTCAAAACATCCAGAGGAGCAGCTGCCCTT
CGAATGTGGATTTACGCCAGGCATGAGTAGGCCAACGCCTTCTCCTCTGACAGCTCCTGGGCGGTCGCATCCATCTTCTTCCTCGAGAACTCATCGATCG
GGAGCCCTTGAACAATTGTCCATTCACCACCACTGCACGTTACTGGGAAGGAGTAGATAAGACCAGCAGGCACACCGTATGAACCATCAGAGTACACACC
CATGGAAACAAATGTTCCCTCAGCGGTTCCCAGAACCCAGTCACGGATGTGATCACAAGCTGAGCTGGCAGCAGAGAGAGCACTGGAGAGCTTCCTCGCT
TTGATGATTGCAGCACCACGCTGCTGGACAGTGGCAATGAACTCCCCATTTAGCCATTCATCATCTTGAACAAGTTCACGAACAGGCTTCTCTCCACTGG
GAGTCTTCACAGTGGCATGGTTAACATCAGGATACTGACTGGACGAGTGATTACCCCAGATAATAGCATTCTTAACGTCAGAAACTTGGACACCAAGTCT
CTCAGAAATCTGACCGAGTGCCCTGTTGTGGTCTAGGCGGGTCAAACAACTGATGTTCTTCTCAGGGATAGATGGAGCAAACTCCTTCAGGATGAGAGCA
TTGGTGTTTGCTGGGTTGGCAACAACCAAAACCTTGCAATTGGGGGCTGCATGAGCTTCAAGAGCAGATGCTTGAGCTTTGTAGATTGAAACATTTTTCG
TCATAACATCCTTCCTTTCCATTCCTTCCTTCCTGGGGAATCCACCAACCATAACCGCAACATTCACACCAGTGCAAGCCTCAACAACATCAGTTGTTGC
AACAACTCCCTTGAGAAGTGGAAATGCGGCATCGATCAACTCCATCTTGACGCCTTTAAGAGCTTCAGCAGCAAATTCAATATCCAGCATATGCAGAATA
ACAGGCTGGTCTGCACCAAGCATAACTCCCCTGGCAATCATGGGAACAAGAGCATATCCGATTTGTCCTGCGGCGCCGGTGACGAGCACGCGCATCGGTT
CCTTCGCCGCCATTGGAGCCGGGGGGTAGATTCTGGACACGGGGATAGGGAGAGTGT
page-top