Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2099
Contig Information
Length 1187 bp
Tissue Shoot grown with dessication
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsd2j12    whsd3g11    whsd3h24    rwhsd10g12    rwhsd2j12    rwhsd3g11    rwhsd3h24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0126B18.7 [Oryza sativa (indica cultivar-group)]
Score 1151
Evalue 6.41177e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2099
TTTTTTTTTTGATCTCAAAGGAATTCTTTCAAATTGTTTCAAATTGTGTCAGTACAAGAGATTATCAAAGTGGGCAAGCTTATAAACGGCTTTATTTGGC
AGATTATCTTTACAGGTAAGAATGTACCAAATCTATCTTGTCTGCAATCAAGTCGTCAATCTCTCTTATCTTTACAGATTGTCTAGTTTTTCTTCGATTT
GAGCTCCGCCACTCTCTCCTCCGTTGCCTTCATAGCTTCTCCGTATATGCTCACCAGCTCATCAACTTCGCCGGGGGTCATTGTCAAAGGCGGTGACATC
ATAATGCTGTCGCCGGCAACCCTAACCAGCATGCCACGCTTCTGGCACTCCTGTCCGAATATAGCACCAACACCCCATTCAGCAGGGAATGGGTCATCTC
GTGATTTATTATTGGCGAACTCAGTTCCGAGTATCAATCCTACACCACGGATCTCCCCAACAATTGGGCTTCCTGCAAAGGCCTTCGTTCCCTCCTGGAA
GCGTGGAGCGATTTGCTTCACATGATCAGGAATATTCCTTTCCCGATAGATTTTCAACGCTTCAATGGCAACAGCGCAAGCAACTGGATGGCCAGAGTAT
GTAAAGCCATGAGCAAATGAACCTAGCTTATTGCTCTGAGAATCAACCACAGCTGCTATTTCGGGGCTAACAAGAGTTGCTCCAATGGGCACATACGCAG
ACGAAAGAGCCTTGGCCAAGGTGACTAAATCTGGCTTGATGTTATACATATCAGATCCGAACATGGTTCCCAACCTTCCAAATGCGGTAATGACCTCATC
TACTATGAAAAGGATGTCATACTTCTTAACCACAGCTTGAACCTTATCAAAATAAGTCTTTGGAGGAGGGATGACACCACCAGCACCCATGACAGGCTCA
GCAATGAACGCAGCAATTGGTTTCTGGTCCTTCCTTGAGGATAAGATCCTCTAAATTTTTAGCAAGTCTTGTTGCAAATTCTTCTTCTGTCTCACCGGGA
AGATGGAAGCGCCAGTAGTGAGGGCAGTCTGTGTGCAGAACAAAAGGTGCTGGTAGATCGAACTTCTGGTGCAGGGCAGGAAGACCAGTGAGACTAGCTG
ATATTAATGTTGATCCATGATATGCTTTTGATCGTGCAATAAACTTTTTCTTGTTTGGCCTCCCCAATGCGTTGTTATAATACCATA
page-top