Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2090
Contig Information
Length 883 bp
Tissue Shoot grown with dessication
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsd10a12    whsd10a23    whsd10b11    rwhsd10a12    rwhsd10a23    rwhsd10b11    rwhsd10b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit conserved hypothetical protein [Pyrenophora tritici-repentis Pt-1C-BFP] >gi|187984529|gb|EDU50017.1| conserved hypothetical protein [Pyrenophora tritici-repentis Pt-1C-BFP]
Score 86
Evalue 1.25756
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2090
TTGACGAAGAGACATTATAGCTTACAACAAGGACACTAAAGAAGCTGAAAATAAAAACAAATCCCTGCATCTTATAGAAAGGACCCCAAACATAAAACTG
AAAACGCGATCGGGTCCACGCTGTGCCGCAGTGGATACAATCATCGCCGACGCCTGGGACAGACCACTTGGTCCGGCGAGACCTCTGTAGCAAGCCACAG
ACTCCAATTTGGCACAGCACTGCCTTCCTTCTGGCATCGTGGCTGGGAGGAACAAGTATGGCCGCCCTTCGACCAGAGGAATCGATGGATTGTTGGAGGA
GACCGGTGTCGTAGCTCCTTCAGATCCACCATCGAATAAGCTCAGGATCCCCATCACCAGCTTCCAACGAGATAGCGGAAGCCCTTTCCCAGATGCGGGG
ATAACACCACCTACGCCGGAAGCTCGGATCCGGCGAGGCCCAGCACCACGAGGAGGCCGAGGCGAGATCTCTCCACCTTTCTGCTACCATCACCACGACG
GCAAGAAACAGAGGAAGGAACCACCGTGGCTCCTAGATGCTGGACAGACTGAGCTTATTGGGAGGGATACTGCCAGATCCAATGTCCACCAGTCCCCTCC
ACCATGGAGGCGAGGTAGGAGACAACGACGACCACCACCAGACTCTGCTCACAAGGTCTAGCAGCAGGTATCCCGACTGGCATGAGGCCACACCATGGCA
TAACGCCAAGTCTAACTAAGTCTACTGCTACTCTAATATACATATGGAAGAACCAGGCACCTCTCCTCAACCATCGCCAGCCAGCATCGCCGACGAACGA
GGCATCAGATCGCCCCGGCCGGGGATAAGCGACTCTCAAAAGGGGGCGGTGGAAGAGATGAGAAGGGGAAACAGCCGCGACCT
page-top