Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2089
Contig Information
Length 829 bp
Tissue Shoot grown with dessication
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsd10e19    whsd3g20    whsd7d24    whsd18f03    rwhsd10e19    rwhsd18f03    rwhsd3g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit eukaryotic translation initiation factor 5A1 [Triticum aestivum] >gi|78191541|gb|ABB29983.1| translation initiation factor 5A [Dasypyrum breviaristatum] >gi|78191543|gb|ABB29984.1| translation initiation factor 5A [Secale cereale] >gi|78191547|gb|ABB29986.1| translation initiation factor 5A [Aegilops tauschii]
Score 845
Evalue 1.10084e-88
Total Hit Count 450
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2089
CCTAGCCTCCGGATCCATCCATCCGCCCCTCGCTGCCGCTGCATCTCGTCTCCACCACCCCACTTGCCCCCGGACCCAGGAGGATCGTCGGAGATGTCGG
ACACCGATGAGCACCACTTCGAGTCCAAGGCCGACTCCGGCGCCTCCAAGACCTACCCTCAGCAGGCCGGCGCCATCCGCAAGGGTGGACACATCGTCAT
CAAGGCCCGTCCCTGCAAGGTTGTTGAGGTCTCCACCTCCAAGACTGGGAAGCATGGTCACGCAAAGTGTCACTTTGTTGCCATTGACATCTTTAATGGA
AAGAAGCTTGAGGATATCGTTCCTTCATCCCACAACTGTGACGTCCCCCATGTTGACCGCCAAGATTATCAGCTGATTGACATAACTGATGATGGATATG
TCAGCCTTCTAACTGAGAGTGGCAACACTAAGGATGACCTGAAGCTTCCCACTGATGATGTTCTGCTTGGCCAGATCAAGACTGGATTTGCTGATGGCAA
GGACCTGATCCTGTCTGTGATGTCCGCCATGGGTGAAGAACAGATCTGCGCTGTGAAGGAAATCGGTGGTGGCAAGTAAGCAGCTGTGCGTGGTTGCCTA
CCTGCGATACTTGGTATCTAGTGCTTCTGGGTGTTTGAGATACACATACATAGGCATCAAGATATCTGTTGGGTGAAACAAGTTTGATCCAGATTTGTGT
GTTTTTTACACCGAATGCTCGAGGTGCTGCTAGTACTTTGTTATCTATCTATCTATCTCTATTATAATACCCTTTGGAATTGGAACTGAGTGGTGGCTGG
AACTTAGATTCCGGTTTGCTCATCCGCCC
page-top