Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2080
Contig Information
Length 757 bp
Tissue Shoot grown with dessication
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsd10b10    rwhsd10b10    rwhsd5f23    rwhsd9k04    rwhsd12f23    rwhsd6h21    rwhsd6h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cobalamin-independent methionine synthase [Triticum monococcum]
Score 902
Evalue 2.28083e-95
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2080
CGTACAACTCAGACTTAGATGAACAATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAAACCACCAAATCAAGGGATGAGCACATCGCGC
CGCACCGAGAAACAAACTAGCCTAACCAACAAGTGGATACGAGACCCAGATTATTCAAAAGTAAACACGGCTATGGTGGTGACATCCTCCTTGCAATTAA
AAGTGGGGAGCTGCTATACAAGCACGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGGCCTCAACCATGTTGGTGAGCGCAGGCTTGAC
CTCGGCGTACTTGCGGGTCTTGAGACCGCAGTCAGGGTTCACCCACAGGATGTTGGTGTCGAGCACCGCGAGCATCTTGTTGACACGGTCGGCAATCTCC
TCCTTGGACGGGATCCTGGGGGAGTGGATGTCGTACACACCCGGGCCAATGCCTGCACCGTACACCACACCCTCGCGGAAGACGGAGAGAAGCTTCTCGT
CAGACCGCGAGTTCTCAATGGTGATCACATCAGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTG
GGTGGTGTCCTGGACACCGCAGTTGGTGATCCTGAAGGAGTGCACGGCCCAGTCCAAGTAGAAAGCGTGCTCAGACTTGCGGAGTGGCAGACCCTCTCTC
AAAGCAGCCTCGTCAATTTGGATGACCTGAATACCGCCTGCCTCAAGATCCTCAACC
page-top